Description :
From Genome Similarity Track
Location :
contig_24:371115- 372205
Transcript NameFunction/comments
g5708.t1RAW35753.1 hypothetical protein PC110_g7942 [Phytophthora cactorum

Sequence
1090 bases(100 bases per row)
GCTGCGGTGCTCTCGGCGCTGCTGCTGCACCCTGTCGAGGCCGAGCAAGAGGGATGTCACTGCAAACGAACCATGAAAGGCCGTGAGCACTTGCACCCGA
AGGTGCATTCGCTGCCGGCCTTGTCGCTCGATGAATCGCAGGAGATCGAGCACCTCCCCGCGCATTTGGACTGGTGTGAGCGCGGCTTCTGCGTGCCCAG
TTGGAACCAGCACATTCCGCAGTACTGCGGCTCATGCTTTGCTCACGGTGCCATGTCGAGCGCCCAGGACCGCATCAAGATCCTCAACAAGCGTCGCAAC
TACACTGGGGCCGACGTGATGCTCGGCCGCCAGAGCTTTCTCAATTGTGCGCCAGGCCACGGCCTCTCCGATGGGTGTGACGGTGGAGAAGCTGTCGACG
TGTACGAGTTCATGCGTCAGTATGGACTGCCGGACGAGTCCTGCCTGCCGTACAACGCGACGGACCACACCAAGTACAAGGAAACCAACGGCACTTGCCC
ACCGAGCGGATACTGCATGAAGTACGTGAGCTTTTTGCCTGAATTCTGGGTCATGGGCAGCTCAAGTTACTAATTTGTTGTGCGGTGCAGCTGTATGTAC
ACTCCGCAGAGCAAGGCGGTGCCTCAGTGCTTCCCGGTGACCAAGATGGTGCGTTACCGCGCCAAGAGCCACGGACACCTGTCGGGTGAGCTGGCTATGA
TGAAGGAAATCATGAAAGGCGGCCCCATCACTTGCGGCATCGCGTGCAGTGAAGAGTTCACGTACGAGTACAAGGCTGGTATACTGGAGGACAAGACGGG
CTTCATGGACATTGACCACGACGTGGAGATCGTCGGCTGGGGCGAGGAAGACGGCGTCAAGTACTGGCACATCCGCAACTCGTGGGGCACGTACTGGGGC
ATGAACGGCTTTTTCAAGATCGTCCGCGGCAAGAACAACCTGGGCATCGAAGCTGATTGCGCTTTCATGGAGCCCGACATCAGCGACGAAGAGCTCGTGT
GGGAGGAAAGTCCGTGTATGGAGGCTCCATCTTCGGCATCGTCCCATTCAAGGAGACCGCGAAGGATCACCCGATCAAGGACACGACCGA