Description :
From Genome Similarity Track
Location :
Scaffold_50:371023- 373139
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15616hypothetical protein
Phypa_INRA-310PPTG_15617hypothetical protein

Sequence
2116 bases(100 bases per row)
GACCGAGAAGTACCTACTCCGGCCTGGTCGTTTTTACCGCCATGAAAGTTAATCTCCACCCTTTGAACTTGGGCTTTACCTTCGCAAATTGTGCCAGCTT
GATCGTAAAACTTGATGTCGGATCGTCGAATAGCAAATTGGTAGATCTTGTTGTCATGAAGTAAATACTCGCTGCGTCTTAGCAGAAAAAAGAAGCCCAT
GACCGTAGCCCCCCATAGGACACGGTCGTGAGCTGAGTGGAAATTGAGTTGTTGGTGGAGTATGCGGAGGTTGGACACCATAATGGGTAGCTTGGGTCGG
GGCGAAGGCCGAAGCCGATGGATTCCTTTGATTGCCATCGCGTGGTGGGGAAGGAGGCCGATATTGACTCCATACTCGCAGCGATGATACCACGCGACTG
CACTGATCTTGGACTGGATGGTCTGTAGTGAGTTTCCTCGGACCGACGAGGAATCGCTGCCGTATTTGTAGCAGTACATTGTGAATAAGACGAGTTGCCG
TGACGAGAGAGCGGGGTCCTCGGGAAGCCACGGACTGTACTCCATTGACGCGCACCATCGTGTCCACTGGTTCCATGAGGAGAGATACCGTTGTCGTGAT
GACGCGGCCAGTGAACTGGATTGCAGTTCGCGGAGAATTCTTTGTAAATCTTCCTCCAGTGCGCGGGCACCTGCACCTGAGTCCAGCCGGACGACAAAAT
TGACCACAAGTGTGAGTAAGGAGATGACCACGAGCGTGATCCTGCGTCTGCCATGCGATTGATCGACCCCGGTAGATGGTGGGCAGAGAGACGAATTCGA
AAAACTGCTTCTGCCAAGCCGATGGCGCGGTTGATTTCTTGACCAAAGCCACTTCTTGACTGAAGCTGATTAATCCATGATACGGCAGACACGTTATCGC
TCCAGCATACCACGTGTGGAAAATGAAAATCCTGATGCCACTTTGAACCCCAACACCAGGCTGCTAACGCCATACAGAAATGTTCGCGTACGTTGATAGT
GAAGCCTGTTGAATCCGAATTTTGAATCATGAGCGCCTCCTCTTCATCAAACTTGAGAAGTATAAATTCGCTTCGCGCAGGGTGAAGAACCGCTAGTCCA
GTATCGGAGGCATCCATGTAAATGTTGATATCAGCCTCAGGTAAAGACCCCAAAAAAAAACCGGAGCGGTAAACGCTCTAGGTGACCATCTGAAAGAATG
TGCTGACACCATTGAAGATCTCGAATTGAACCAGGAGTTAGGCGAATTGACTGGAACACTTGGAGGCGAGAACACAAGGCCTGTAAACGCTGATAAAAGG
GCTTCGCAGACCGCAAGCATGTCAAAAGATGTCGGAGACTACCGAGTAGCTTCTGGAGATGCTTCTTAGTCACTTTTTCACAGGTGAGCATGTGGACGAC
GCGGTCCAGACACTTGTGGATTTTTGCCGCTGGCATCGATACTGTCCGATCGGTAGTATCCCAAATGAGACCGAGAGTTTGCAGTTGCGTAGACCAACCG
GAAAACTTTGCGTCGTTGATACTGTCGGGATCCAAAACCGCCATCATACTCAGACGCAGCGTCGATTCTGCGAGCTCGAGGCGGCTGTCTCGATCGGGCT
CAATGAGAATATGATCGTCAACCCATTCGTAACCGAAAAGAGTTCATCATCCTCGCTAGTAGACACGGATGCAGGAGAGTTAGTACCGACAAGCCAGCTT
ATTGCTCTCCCGAAGGCACCATAAAATGCTGGTGAGCCGGACCAACCGAATGGAGCTGCCAGGTCGATGACTAATGCATTTTCATCCGGGAAGGTTGCTC
CCATCCAGCGAACGTGTGATGCATGAAGCATGAGATGACGGAAAGCTGACTTGACGTCACCCTTCAGCATCTTGATCACAATACCAGGATGAGCTAGAGC
TAGAACCTCAATTCGTCGTGCGAGGACAGTCACACTGGTGTATGCGATGTCCGGAGCGCTGTCAGAATCGAAGTAGTCGTTGGTAGAGGACGCCTCAGGG
AACGAGAGGTCATGGATTGGGCGAACCTCGACTTGCGGGTCAATATCCTTTTTCTCCACAGCACCGAAAGGACTACATTGAATGCTACCCCAGAGGTTTA
GCATGGATAGATTCAC