Description :
From Genome Similarity Track
Location :
Scaffold_537:3710- 5781
Transcript NameFunction/comments
Physo_145150reverse transcriptase

Sequence
2071 bases(100 bases per row)
TTCCACTCGAACAGACCCATGTGGGTGATAAAGGCCGAGATCGCACGAGCTCGATCGGTCATTGTCACCACCCAGAATCCACTAGCCATGTCCAAAGAGC
AATACCAGAGTACCTTATCCAGATCCTCCAGCAAATCGTTGATCAAGGGCATCGGATATACCATCAGCCTGGTTAGACTGTTGACGAGCCGATAATCGAT
GCAGAGTCGGATATCCACGCCGTTCTTCTTGATGATCACGACAATCGGCGAGGCCCACGGTGATCGAGATTTCCGAATCATCTTGGCTGACAATAATCCC
TTGATCAGCTCGGACACCTTCTCCACGAACTGAGGGGCAACTTTCCGGACACGTTGAGCGATCGGCTTCGCGTCGCCCACGTCGATGTCGCAGGTGACGC
CCCGGGCTGCTGGGGGAAGTGCATTGCCCTTGCCGATCAGCAGGTGATTCCTGTGCCAGATCTTCTTTCGCAGCCGATCGATCTCCTCCGGGGTGTTGAA
CTCCAGATCTCCCACCTTGATATCATCGATCTTCACCTCATCCGTCGTCAGATCACAATTTCAGGAAGCACAGCTAATTCACCTTGGACATCTTCTGCTG
ACAGATTCCCGCCCTCGTGGTAATGGACCTGATCATCAGCACCAACGTCTCGATCTGGTTCGGATGCAATGAGGTCGTCCCGATTTGAAGTGAGTTTGGC
CTCCTTTTCCAGCTGATCCCCTCCAACGTTCGACGAGTCTTCAGCCACTTGCGGCAGTCGTTCAGATGCAGGAACACCGTCGACTGCTGTATCGTCACTT
GATCTCGACTGTTCCACAGCTAAGACCGCAAAAGGGTGTGTCCGATCGGTACTCCCGCCCCCAAGATCTGGTTCGACGGCACAACCGTCGACCAGATCGG
CCGATGGCAAGTGAGGGGACACGATTTTGCCTTTCTCAGCTGCTTTACCACCGGAGTCCACATGATCTGGCTTCCCCTCTGGATCGCCAGCACGATCATC
TTGCGGCTTCGCGTCATCTATCGGTGCATACGCTTGATCCGTGATCGGCGAAGGCTGGGAGTCCAGCCCCACCTGTTTCCGCTTTGGAGGGCATTCCTCC
TCCGATCGGGAAGGTTCACACACCGACTCAACACGATCCGACCGTGGGTCTGGTGGATCTCCGACGAGGACGGTTGAAGCTGACGACCCCGACTCATCTG
TCACGCGATCACCGTCCTGCAACGGTCTGCCTCCTGATCTAGGAGTATCAACGACGGCCACCCCCGGATCAGGGCTCATTGCCTCCGGTTCGCTTGGTGG
ATCGGGTGGACCCGTCGATTGATCGACGATCGGGGATACCTTGCGTCTCTGGAGAATGGCTCGGGGCGTTGGATAAATCGGTCGCTCGACGGCAGGTACT
GAAGGTTCCGCTGGTGCCCCCTGGCCCGTCGGCCGGTCATCTATCGTGGCTTGAAAGGCTAGATTCTGCCATTCCATGTATCGACGAGATCCGATCGACA
CATATCCTGGGATCCGGGGTATCCGATCTCCGGCCAGCCACATCCCGATCCGTTCATTCCAATGCAAGACAAGATCTTTGTCACTGATGTTGGTAACCTG
GAGATATCTGATCCTGCCGGGTCCTCGGACCACGGTTGGCACCCAACGATCTCCACGGGTGACCCATAGCTTTTCTCGATCGGTCACTCGGGGGGCCGAA
ATTGGGCCCTTCGGGTCGTCGATCTGCTCTGGCCGCACGATCACCATGACAGGATCTTGACGCAAGAAATCTCGCGGTTCCTTCAAGTAATACTGACGAT
CCAGGTCAGCCTCAGACCAGTCGAGCGCCGACGGTCTGGGATCTTCGTCGTCCAAGCCTGGCGCTCTCAGCTTCTTCCTCACGATCTGGGTCTTGTCCGC
GATCGCGTCCAGGTAGCCCGGATCGAGCCTGATCGGCGAGTCAGCGAACGCGTATCGGTCTGGCCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGTTC
GCACCAAGATCCACCGGGGTCCCCGAAGGGACCTGGGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTC