Description :
From Genome Similarity Track
Location :
Scaffold_1477:371- 4868
Transcript NameFunction/comments
Phyag_g10740hypothetical protein PHYSODRAFT_507752
Phyag_g10741conserved hypothetical protein
Phyag_g10742kinesin heavy chain, putative

Sequence
4497 bases(100 bases per row)
TTTACCCCATAAATGAGAATTTACTCACCAGGGACTAGTTTGCGCTGGTTCCTGGGCACGGTGAAGCCTACGGTCCCAACAGAACGAGTGAGGGTCGTGG
AGGTGTTAGTGAAAATCTTGAGCCACTTTGCTCAGCGCTTTAAGATCCTCTGCCATGCCCCATGCGTTAGCTCCTTCGTCGGAATCTGCATTCCACATGA
ATGAATTAGCCCCGACTTCAAATACACAAACGAATGATTAGTTGAAGTGCAGACTAAGCCTAAGCCAACAGATATCATACACATACACTTGATATCCTTC
GATGGAGGACAACCACCGTGGAGACTGGCTGGATCAAGGTCATTTTCGGGCGTTTGTGAGTAAAACAATGACGCCGTGAGCTTCACGGGAGGAACTGCGA
GACCGTCAGAGCATTCTTCCATACCGTCCCGCTCGATTCCAGTCACTAGCCGTTCTTTTGAGTACGGGAAGATCGTCTCGCCACCACCGGGACAGTCGTT
CAGATACAGAAAGAGAGTCACAAAACGATTCGGCTCAAAGTGGTGCATATGTTTCGGCTTCTTGTAGACGAACAAATCGCCAGCACGCTTGGTCCACGAC
TCCACGGCTAGGTCAAAAGCTACTGGGTTATtgcgcagcacctccagcagcacatcgtTCTCCTCTTTGTTCTCAACCATCCATGCGTGCAATTCCGCTG
TCAGTTTCTCGACAAGGAACTCTTGGCTGTAGTCCTGGATAATTTGATCGACCAAACGATTTTGAAAACTCACGTAAAATGTCGGGTAGTCGTCTCCTTC
AGGTCTTACTCGCTTAGGAACAGTCTCATTTTGCGTGTCCATCAGCACTTGTACTCGCTCCTTAGCCCAGCGTATCCATCGGAAAAAGTGCGAGACACCA
CCGATCTCGGGTTTGGGAAACGAAAACACAAGTTCAGGGTTTCGAGATCTTTTTTCCCATGACGCGACGATGAACGGCAGCATATACCCTTTCCTTTCCA
AAAGCGGGCCCATAATATTGTTTGCTTTGAGTTCTAAGTTCTCGTAAATCCAATCTCGCCAATTCAAGTCGGCGTGTTCCCAGAAGAAGTTGCTAGCTTC
GGCATCTTCCATGAAACCATGTAACAACGCCTGGTGAAACGTTGTGGTGCTCTGAATGTCTGGAAACAACGAGCCACCAGGCAAGAACTCGACGGGGACA
ATACTGTCGCCATGTTCCTGTCGAAGCTCTTTGATCTTGGTCGAAGCCCACTCAATCCACGCTTTAAACTGACTTACCGCCAACTCCTTGCTTGGAACAA
ACTCCTTCGAGTCAAAATAGTCCTCGTGCTTGCGAAAGAATTGACCCGTTTCGTACCGCACAAGCTGCATCCTCTCCGCATATCCAGGAGATGGAAGACG
AGCGAGGCTCGCCGACCTTGCCCTAAAGTCCCGTGTGAATTTGCTATCATCAAGAAACGCCGTGAAGCTCGTGCGATCCTCATGGTATCCGTCCTTCGCA
TCAATGCTATCAACAGGAGAGCGAGAAAGATGGTCGATACCTTCAGCGATGATggcatctgcttcttcctgcgtGAAGAATCCCTCCACCGTAAACACCT
TCGGGTGCAGCGATTGTGTCGTGACGGTGCAGCCTTCGATCTCTCGTACGTAGCCCACCTTCACCCCAGGCCAGACCCAGAGTTGTCCGTCCAGCAAAAC
ATGAGCTATGCGTTGGGTATTCAACTCGTCCGCTGTGAGGATCGGCAAACCGTCAATAGAAAACAGCTTCAGTCCATTGGTCAGTCGGCCCGGGTCGGCT
CCAAgctgcaatgctgctgtATGGGCCAATTCAAAGAGACACGCTTTCTCGTGTGTCCAGGACAAGCGGATCCCCTCGTTCTGCCCGTTGAGCATAAGGA
AGACTTCGTTCTggtcttgaagctgctgctctcgaccCAGCACTGCCTCCACGTGTGTCAAGGCTTCATTGATCGGCTGGAAGTCGGGGCATTGACGGTC
TGCAGTTGCGCTGGCTAAGAGTGGATGCGTGGCGATCTTCACGACGTCACTCGAGTATTTGTCCACCAGAATCGTAGCGGAAGGtgacgtggtggagacg
tCGTGGCCGAGTCGCTGAAGCAGCCAGTCGGGTGACGTCCAGACGGCCGCGAGAAGTGCCACTACGACAGGCAGCGCAGCGAACGCCACAAGATTCCTCG
CCATGGGGCTCGTGGTTGCAGACGCCATTGTTGATGCAAACTCTTTTCGGGCATCGACCCCAGTTTCCAGACCCATTCCGTTAGGTATCTTGCTTTCCTA
GCAGAAATGGTCAGGAAAGTGGGCTGGGATGAGACGAGCGCGTCGACAGCTCTGATTGGGGCGTACGAGGGCGTACGTCCACATCCCAACACCTCTTGCG
TCAGTCACTGGCAAACGGTCATTCTCGCTTTTGCCGCTGCGTTCGTAAGTGAatcaagaagatgcagtcCGCCGTGCTCAAGACCTGCCGccgcgccgcc
tccgccggcCGCGTGCGCTCCACACGCGCCCTCACGACGTACTCTGGCGGCCAGCCGTCCGAGGGCCAGGGCGGCTTCTACGGCTCGGCCAAGACGCGCT
CCGAGgccagctccaagttcaGCCCCGGCGCGCGCGCCGAGCCGCAGGACctgaccaagctgcagcagctgatgaAGCAATGGGAGACGCAAAAGGCCTC
GCTTGCCGccgaggagcagaagaaggagctcgcgCGGATCGccagcgaggaggagacgctcATCCAGCGGCTGCTCATCCGGGGCGCGCCCGTGTGGGGC
CTCTCCACGCGACAGCGCGAGTTCGTAGCCGAGTGCAGCAAGGCCAGCGCCTAAGTGTGTTGCGTGTCTGCTTACCACAGCTCGCCGCGCTGTCTCCAAG
TTCATATTGTAGTCAGCTCTCAATCTCGGACGAATAAAACGAGATACGAGCTATACAAATGCATCACTTTCCCTATTGCGTTTCTTGACTGAACTTGTAA
AGCgaacgctgctgtcgtcatcGGAGCGGGAGGCATGCGTTTCCAGGGAGCTCTGGTTGAACCACCACAGGAATCAGTGATTCCtgtggtgcagcacgag
aTTCGATGTGAATGATGTGAATGATTTGAAGGCATCCAAGCAGAAGTCGCAGGCAGAGACAATGCACTTTGAAGCgatcgacgtcttcgagGATACATGC
ACTTGTGCTTGGTGGCGAGGAATCCTCCCCCGAAGAAATAATGGCCATACTGGTGGTGGTACTGCACTGCACACCGAGGGAATATGTGATGCGGCAATTC
GGTTGGTAGCGTGTTTTGTTAAAATTGCCTTGACGAACACCTTCATGGCGCTCACTTACATTGCCTTATGCTAAACTCGAGGGCAGTGCTCTCACAGGTT
GAGAGGGGTGATCGACTTGACTCGTTGGCGTCCATGCATTGGAACGTCCAGTGatcgctggcgctgcatgCCCGACAACGGGCCCACTTGATCACGATCG
TCTTCCGCGCTGACAGCTCGCCTCAACGTAGGCGGCGCTTCCGTAGCCTGTTCAGTCATCTCGGCCGAAGGATCTAGCAAGTCCGAGAGTGCTTTCGATG
CTCCAGGATCATTGGTTTGCTTCGAGTCCGTTAGATACATGCGCAACGTCTCCAACCTAATGCTAGGCGGCGAAAAACCTTCCATTTTGCCTTCATCTAG
GCCGACTGGGGCAGATTCAGAgtcttcgttgtcgtccCAGtcagcggcttcttcctcgGGCATCTTCTCTGCAAACCACTCCGTCTTCAGCGAAATGTTG
GAGCGCTCACTTGCCAATGCACCGAGCTGCGCCACTAGTCGCGCTCGAATGTCGGGGTGGAGTCCACTCTTGACGATCATTTTGTGGTAAATTTTTTTGG
ACCAGGCACCCGATACAATAGCGCAGAGCCACTTGACAACACGCCGGAACTGAAGGACGTTGTCGTGGCAAATGTGTCGACGGAACAGTTCGAAGAGTTC
GGGATACTCGCCGAGCAAGCGGTGCTTCTGTACGGCGAGTTGTTCAATTCGCCGACACAACTCGTTGCTGACCTCGAAACCGTGGACCCCGGCAGCGTAG
CAGCCATCGCATAATTCGTAGTTCTCACATGTGTTGCATTTCCACTTTCCACCGACGATCGGACTCATCCCGCAACCGTCACACAAAGCATTTTGATGTA
CGTGGTGCTTGTGGTAGCGAGCGTTAAGTCGCGTCTTGACATCCCCCAGCATGGTTCCCATTCCCGTCTTGGAGCGTAGTCGACTAAATACACCACCGCT
GCTTGGGGGACTGGGCACAGGAGTACCAGAGAGCGATGATTTTCGACTCAGCACTGAGGGAATAGACTCCGTGACGCTGGCGTTCAGATCTACAGGATCT
GATGTGAATTGGTCTTTCGTCGAGACCAGTACCCGACTTGCGTGGAGCACTGAATGACTGGATGCATCGCTCTTGGGCCCATAAAAGAGATGGTCCT