Description :
From Genome Similarity Track
Location :
Scaffold_4272:371- 2252
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4272-fgenesh-gene-0.0Translocation protein SEC63

Sequence
1881 bases(100 bases per row)
CGGACTGTTCCGCGCCGCGCTGCTGCTCCAGGACGACTCGGAGATCAAGTCGTTCGATCCGTTTATGATTTTGGGCATTGCCTCGGGTGCCAGCGAACGT
GAAATCAAGCGCGCGTACCGCAAGATGTCGCTGCTGTACCACCCGGACAAGAACATTGGTGACGCGGTGGCCGACCAAAAGTTTATGCTCGTTGCCAAGG
CCTACGAGGCACTGACCGACGAAGTCGCCAAGGCCAACTACGAAAAGTACGGCAACCCTGACGGCCGCCAGGCGTTGCAGCTCTCGATTGGTCTGCCGAC
TTTCCTGCTCGACCCGGCCAACCACAACATTGTGCTGTTCCTGTACCTTATCATTTTGGTCGTGGCGATCCCGTCGTGCGTTGCGCTCTGGTACTCGCAC
TCGAAGAAGTACGGTGACAGCATGATCATGTACGACACGTACGGCTTTTTCAACTTTGCGATGTCGGAGAACGCCCACCCGCGCTTGCTACCCGAGATTC
TCGCTGGCTCGGCCGAGTTCCGTGAAGTGCCCAAGCGTGCGACCGACCCCGACGAGCTCAACTCGCTCCAGAAGAAGTTCAAGGCCAGTGACATGATGAT
GAAGCCCAAGTACAACCATCCGTCGATTGTCAAGGCCAACACGCTGCTTCACGCGCACTTTTTGCGGGAGAAGCTCAGCCCCGCGCTCAAGAGCGACCTC
GACTTGATGCTCAAGAAGGTCATCCCGCTTGTGGACGGCATGATGGAGATCTCGGTGGGCAAGGCCTGGCTGCAGACGACGCTGAACCTGATTGAGATGG
AGCAGTTTTTGACGCAGGCGTTGTGGTTCAAGGACCCGCCGTTCTTGCAGCTGCCGCACTTGACCGAGAACGAAGTGCGCCACATTATCAGTGGCAAGAA
CGCCGTGCGCAGCATGCACCAGTACGTCGACCAAGAAGTAGATGCGCGCAAGGGGCTCTCGGGTTTGACCGACGAGCAGCGCGCCGAGGTCAACAGCGTG
TGCAGCATGATGCCGAACATGGACCTGCAGATCACGATTGGTGTCGAAGACGAAGAAGAGATTGCCGAGGGTGACATCATGACGGTGACCATCAAGCTGA
CCCGCAAGAACGTCAAGGAAGGTGACACGTGCGACTTGGTCTACGCGCCGCATTTCCCGTACCCGAAACTCGAGCGCTGGTTTTGCATTGTCGGTGACGT
CAAGGCCAACCACTTGCACGCGTTCAACAAGATTACGACTCAGGAACGCGAGGGCGAAGTCAAGCTCCAGCTGCAGGCGCCGCCCAAGGCCGGCACGTAC
CAGCTCGACATTTTCGTCAAGTGTGACTCGTATGTCGGGCTCGATCTGCGCGCTCTTGCTAAGGTATGTTCGCCACCCTTCGCTTCCGGCTGCTTTATCC
CTTTCCGTGGTATTAACTAGAGACGCTCTGTTTTTGTGATGTAGTTTAATGTGGTGCCCCAGTCCGCGCTGCCCGTGTACCAGCCGCACCCGGAGGATTT
GGAGCTGGACAACGAGCCGACGCTCTTTGAGCAGGTCATGAACGCGGCGGACTCGAGTGATAGTGAAGAAGAACAGGACGACTCGGAGAGCAAGAAGGAC
CAGTAAACCGACGAGCCAGACAGACAGAACATGCGTTGAGGAGGCGGCTGCAGAACTCGTGAAGTGGTCTGGCCAGTGGCGTCGTACGAATGGAAGTACT
GGTTGTTGTCACGTGCCGACTGTAGGTAGGTCATCGCGCTAGTGCAGCTTGCCCACTCCACATAGATACCCATTTTTCCCATTTTTCTCCTTCCCCATCT
CTCCACCTGAGCTTTTCATCATCTGGACTGAAACATTCGTGTCACATTGCACTGAGCAAGCAACATTCAAGCAACATCACT