Description :
From Genome Similarity Track
Location :
Scaffold_20:370981- 379592
Sequence
8611 bases(100 bases per row)
CAAGAGTGACTCTGCTGTTATGGTCCGGCTCGACGTGGGTGACTTTGTGCTCTACGCGGATGTATGGGTCAACACGCGCACGAAGCTGAGCGTACGTTGG
TGTGGCCCTGCGAAGGTCGTTGACACGAAGTCCAATTGGATTTTCGTAATTAAGAGCCTAATAACCGGTGAGCACCGCTCCGTGCATGCCAGCCGCCTGA
AGTTCTACGCCGACGCATCGCTAAATGTGACGGAGGACTTGCTGCAACACATCGCTCACAATAGCGAAGGACATGTCGTAGACGAGTTCCGTGGAGTATG
ATATCATATGGAGACGAAGCAGTTCCAGTTTCAAGGGCATTGGCGTGGCCTATCGGAGCTTACAGATTCATGGAAACCTGCCGTTTCTCTGTTCGAGGAC
GTTCCGGTGCTGGTCCGATCATACGTGCAACGGCATTCCGATGATGCAGTTGCCGTACGTGTGGCCAAGGCTCTCAGTATTGGACGGTAACTTATTACCG
GGAGGGAAGTGCTGACGGTGGCTTCAACTTGCCACCTTGAAGCTGTACATGCACTGTGGACTGTGGCACCTCGGTGGATTTACAGCTCACTTCGTCGACG
TGGACCAACCGAGGGCTGAGGCGAAGGCAGAGAGGCAGGGCGAACAACGTGGATAGTTCCAAGTGGCTGTATACTCGTGAAATGGGTAGTGTCAGCGGCT
ACGGACTGGATCGTGTCCGGTGAGTGTAGGACTCATGGGGAGTCTCTACTGGATACCAAGCAAAAAGGCAGCCGTGATACCTAGCTTACAAACCGTTTAA
TTCATTCACTTTGCCTTTAGAAGTCAAGGTCGCAGCCGCGACAAACAACAGTTGGAGTACGGTTTCATGAGTGAGCGGGTGGCGATTGTGTTGATTGCGG
CTTTGCTTATCGTTGCAGCTCCTTGGGTGTATCGGAATGGAGTTGGTGACCAACTCCATTCCGATACCAACTGTTGGTGTGTAGGGCTGGAAGGCGTGTT
GGCTGCTGAATCCTGACCTTATCGTAGAGCCCCTCGCAAGCGAACCTCAACAGAAGGGGACCCTCCGCGTCGTTTGTATTTCCGATACCCATGCCAAGTA
CCGTAACCTCAAGAATATGCCAGACGGCGATGTGCTGGTGCGCTGCGGAGACTTCACAAAATGTGGGACACACGAAGAGATACCGGATTGACGAATTCTC
TCATCGTCACAAAATAGTGATCGCTGGCAGCGACACATGCATGGATCAACCCCTTTATGATCTCCATTAGGACTCACAAACTCGCCACAATACGTACAAT
GATCCTGGATTATCAAAAGCATTGCTGTCCAACTGTACCTACTTGGAAAACGACTGTGTAGAGATCGAAGGGCATCAACATATATGGGTCACCAGCGACA
CCTCCTATTCCCGGACGAGTAGGTGCTTTCAATGTGATTCGTGGCTCAGAAGATCATGAGCATTGGAGTAACGTCCCAGATGGTGTGGACATCTTAGTCA
CACATGGACCACCACACGGCATCTTAGATTCGACTTTTTACTGAACTGCATGTGGACAGTAAAGCACTTTTGAGCGAGATTATGTCTTGAATTCAACCAA
CTTCCATGTCTTCGGTCATATACATGAGGCTTACGGAGCAGCTCGCGTACGCAAGACTTTTTCAATCAACGCTGCAACCAGAGCACTTCTCTCAAAACCC
CGCCATACCCCCGTCGTGTTGGACATCCCGATTGAGTGCTAACATTCTTCTACTGAGCATATGCATGTCGTGTTGCTGAGTTGATTGGTGCTAGTATGTT
GCCATTATCATTTCTTATCTGCAAATGAATCTATTTCGACTGTATAATTACGTTTATCGAAGACTCAGGGATGGACAGAGGACCTTGACCTGGACTCATG
TATTGATTTTTCGAAAAGTTAGTCTCTCGCGAGTTCGAGTTCACCGATTATTTCGCATTACCCCGAAATTGATGTTTGCTTGCTTAATTTTCAGCTAAGT
ATCCGTTCAGCCCAAGGCAATTCTGACATCAAATGAAACAAACCAAAGCCGGGGATACGGGGGCATACGAACTAAACCGATGGGACGATGCTAGAGCTAG
ATGGATATTAACTGAGTTCATGCGGTACCCTTGTTGAATCAATCGACATTATTCGTAGAAATATCAAAATTACAGGGGAGGGCTCTTTTGGTTTTACACT
TGCTAACCAAAATGTCTTTTAAATTTGTGTCTTTTTTTGTTGAAAATTACTAGTACTGTATTTGATCCGCAGAATTATATCTTGTACGACAGCATATCAT
GTTTCTGAGCATTTAACCCTATCGTTAACGCCATACATTTCTATTTGAAGAGACACCATACAAACTTCAAGTACAACGCCCTAAAAGGATACTTCAAGTA
CCTTTCTACAGCACAAATGTGCGAGGTTTTTGTCCAAAAATTATGCAGTTGTAGAGGTTTTGTGCAATACCGGAGCAGAAGAGTACCTCAAGTATCATTT
TGCACTGTCTTTTTTTCTGGATAGCGATTGGCTGGAAGCCATCTCAGCCAGTTTTCGCTTACGAAATAAAGTCAATAAGGGGAGTACCGTGGCCTACATG
ACCTCTTGATCCATGTGGCGTACACAAGTTGTGCCTCAATTGCACAATCACCGGATTTGGACAGCCTGGGCGGCGCTACCGCTACATCCGCAGACGCAAC
TCCACTACAACATTTGGGCAGGATCGATGTCAAGTGCAAGCCCGCATCGATGGTCGACGGTGTGCTGACCATGCTCAAGGGTGTAATCAAAGCCATGTGG
CTCTATCTGCTAACGGCCAGGCCCGAAACGGCCTCCCGCATCGAGGACATTCTCCGGTCTATATAGGGCTGTGGCTTTGTCTACGCTCGGTTATGAAGCC
GGAAAGAATGCATTATCGCTACTTGGCTTGAGAGCCAACCCCCGCCGGTAGGGTAGCTGAGTATGCCGGTGAAGAGGCGGTCACAGAGTTCATTCTTCCA
CCTGATGAGATCTGCATGCTGTGCAGTGCAAGGCGCACTCGCGTGGCACAAAAATACCGCCCATGATCGCCGACATCATTGACACGTATTAGACCTACTT
GTCAAGAACCAACTCCGGGGTCTACGTATCCTTTCCCTGCCTAGGCGTCAGCGAATTCAGTACTAGAGGTGCAACACAAAATTCTGGGCGCTTGTAGAGC
CAATCGGCTCCTACAACGTGGCGATAGTAGTAGAAGTAGCTACGAAGCTCTACCGAGCTCGCTGCGTTGCTATGACTAGCGGCAACAGCTCTATAATTGT
TTCTCAATGCGAAACTCTTAACGAGAAGGCTAAACTCGCTCTAGTTTCATTTTCAAGTCGTATTGCGTCGACAAGCGCAGATGCACGCACCCTTACTCCA
GATTTTAATTTGTGTATTTTACTCCAAAAATGTAGAAGACAGCTGTGAAGAAATCTTCTACTGTAGTGCCACCCAACTTGCATGTGCTTAGTTTCCGCTC
AGTCTAGATTTTGCAGTCTCCGGTGAAGATGACTCGTGTCGAGTCTGACGACCCGGTCTGTCGTTCATCAATCTCACACGTGCCAGTGTATAGCGTGTTT
AATCAGCTACCAAGCCCAAAGGAGATGCTGTGCCGGAATGAGGGCTCTGACGTCAATCTCAACATGGCGCGTGTATTATACCCTCGTTTTTACAGCTCTA
AGCTATTGATTCTTGTGTAAGCCAGGCCCTTGAGTACTTCACTGTTGGCACTCGCAAGCCTATGGAATTCGACAATTTATACCCCGTTTTCTATTCGCTT
GATCACCTTGTACGCTGAGTACGTTTATTATCCGATACTAGTGTCTACGCTGACGCGTTTTGTTGTTAAGGAGCGTGAGCACAGCTTTGGCTCTTATGCC
GGAATTGATGATTTCGTTGGGGCCCTCCCAGTGAAACAAATGTACAGTGTTTATACAGGGCTTTATGCCGGCAATCATCACCTTCTTCACGAATACATCA
TGATGTTGAGATGGCTTCGATCCTCTATGGAAATTTCGGATGTACGACTCTAATTTTTAGATCTGTGTCAGTTGAATACAGTGGCTAATTTGTTATCGAT
ATGTATAGATTACTCGCAACCACCTTCACGATCGCCTAGATTTCTTGAAAGTCTACCTTCAGTATACGCGGACCAAGCTCGATGAGCACTTCAAATGCTA
CAACGAAATGAAGGCGGACGAATCTGTTGATAAAGAGTCTATTTACCTTCACAAGAAGGATGGGTTTCACAAAGAGCGTGGCTACACTATTTTTGTGTAT
CTGAGTATGACCATGAGCGTCATCTATGTAATGGCGAAGCAAGCTAACAAGCTTCAATGCCAGCAGTGTCAATGCACCAAGTACATGTACTACCGGTCAC
CAAAGTGGCGCAAAACGAAACCTGTTGTCATGGAGCCTGACACGCTACCTCCTGTAAGATTCTATCGGCGGGGAAGCCAAGGTGTGAGCCCCTCTGAGGC
AATTTACCGCAAGCAGCGCGAGAAGAAGTAACGTGGTTGTCTCCACTGTAGATAATGAAACGCTCAAAGCAAAAGTATGATTTATTGCGTGAGATTACTT
CCAGTTATGCCTACCAGCACCTTAGCCTCGTACGAAACTGTCAACTGGATTGGTCCTCTACGCTATCTTTAAGAAACTTTACCGTAGCGAGTTCGCAGCG
ATTCTCAGTAGCTACGATGGTAGCTGGACTCGTATGTGGAGGCAGCGAGTCGTTCAGCAGCTTCGTAGCCGTGTATGTTAGCGTACTGCGGCTCCTTCAG
CGGTTCTTCATCAACTGCATTAAATAAGCACACCAGTAGTCTGACGCTTTTGCCGCTCTGCAGTGGTGGTTGCGTACAACTCTGACGTGCCACAGGATCT
CCAGTACATCTGTTTTGCTGACCTTCGTCGGTTCGAAAGCGGATCAGAAATTCTTTGGTGGTTGCAGACGTGCTTGATCCTGAGAAGGCCTTTCTTCACC
TTAGCGGCAACGAGGCGCACTTGTATAACGCGCGGAGACCCTTTTGGCAGCGCTGTGATGGCATGGCGAGAGCACGAACTTGCCCACACCTCCTGCACTT
CTGCCGTCAGGGCAGCGTATATGTGCGTAGTCTGACGGTTCTCGTAGAGCTTAGTACGTGTACGGAAAACCCTGTACCCATGATTCGCCATTTTTTTCAG
TAGCTCCGCGGTGACGGCTCCATATCCGTCCAGCGTAGTTATGCTATTGCAACGGTTCGACCCTGGACGAGGTACGTCTGCCGTTTAAATACGGGTTTTG
CTCACTTGCGCCATGTAGTAGTACATCTAGCTTATGAGACTGTGTTCGCGTCCGACGTGCACCGAGCCGTTAAGAGTTTGAAGGCGGGGCGACCGATGAC
GATATCCGAGGCGATAAGGAGAGCCATGCGCATTCGGCCTTCCCCAGGATTGTGATCAGCTCTTCAGTCGTGATCTGCCAGTAAACCAGCGAAACCAAGC
CCTCCCGCATCTCCTTGGTTAAGCCGCAGATGGGTGTACCACCGAACAGGTTCTTCAGTAGCTCGGGTCCGTCGATGAATATCCATATGTGGCAAGCAAG
GCTCCGCCTAGCCAAAGCGGATCAGTGCCTTGCTGGGTTGGCTGTACGGGAGTGGGAGGCAGCACTAGTGTGGTCGAAGATGACAGTGTCGGTCATTGAG
CTGTTGGACTTGTGCGGCTTTCGTCGAATTTGGAAATGAGCCTTCGTTTGCCGCGCTCCGCACGGCGAGATTTTGCCGCCATATTCGCTCGCCCCGTGAG
CACGCTGTGAAAGCCACGGTTCCTCCAATCACAACTCTTGAATGTGTGGCTTCACCAATCACACGACATGCCACTATGAGTACAAATACCTTATTGGTGG
AATTATTGATGTGAACATTGGGGGGGAAATACAGCCCGTATCTTTTCCACTACTTCAACTTCGCGCCAAATTTGAATTGTTCGCATCAGTTGTACTACTT
TAGTACTTTCCAGTACATCGTTATATCCGTTGCAAAAATCGTGACCTTCTAAAGCGCATACTAGTACCAATAGGTTTTTGTGACGACGACACTTTCGTCG
TAGCACGAGCACTCTACCAGCATCACTTACGAGTTGAATACATGCCACTATGTTGAAATTATGCCCGTCCATTAGTAGCTATAGTCCCAATGGAAAACAA
CAGAGAAGCTGCCACATTGATCACAGTAGACCTACAGCCTTTACGATGGATTCTTTATTTGGATCCGACATAGATTGTTACTATAAACTTTATAGCTTCA
TCGTTTCAAAGTTTAGTTGGTCCTTCCGTAAAAATCACAATAGCAATTCAACGAAGATTTGTCTTCTTTGAATTTACATACTCAAATCAGCATGTCTGCT
ACTGTGTTCTCCCCACAAATGTCATACTGAATGTCATAGTAGGACGGTGGCTAAATCATTCGTGAATAATGCCGAGCACTAACTTCCTCGAGGAGGAGGA
CAAGGAGCAGGTGCAAACTGCAAACTGCACGTCACCATGTAGGGCCAAGGGGGGGGCATTGAGTGGAAGTGAAAATGTTGTAACATCCACTAGTGCTTTA
TTGCTAGCAGTAGTAGAGGTTTTGTAGGATAATATAAGCGTAAATGGAAGGTGAAGTACTGTAGTAATGCTTGCACTTCTTAGCAAGTCTATGAGAATAG
CAGAGGCGGCAAGGTTCATGAATTCAAAGTCAAAGCAGAGCATAACGCTTCTATTTCCGACGATGAGCTGGCTTTCGGAGCGTACTGAATGTGATAATTG
CCAAGAACCACAGCAAGCGGAGTAGCGGAAGCCACTCCGACGTGCTTTGCTTGAAAATGCGGTGTATTAGCAGCGATAAACAGGCACACTAGACCTGTTG
AAGAGTGCTCGAACAGCAAAACCACGATATTCTTTGACATTGTATCATACTACGGAGTAGTATTGAACTGCTTTTCTACACATGCAAATATATTTTATTT
CTAAAATAAAATATCATTGCATGTGTAGAAAATACTAGTTTAAAAAATTAAAACGAGAGCTGCAAAGTGAAGTAAACCTGGGCGCAGTTCACTGCTTGTC
GTTATGGCTTCGTCTACCGGACTCGGTGTAACACTGACGGTGTTTGAAAATGAAAAGTTCCTTTAACCTGGTGGATCTGTCGAGCACACTTTATCAGCCA
TGTTGTGGGCACAAGCACAAAAGTACCTCTATTATAGTACTACTAGATGTAGTATTCCTAACCACGACTTCAAACCGTCCAGCTGTGCTGTATGAATAGT
ATTATTAATTTTTAATATTTGAATCCTAAAATCCTAATCTCACAGTGAAGACCGGTTTGCACACGTACTACATGTACTAGTGCAAAGCAATGTAGTAGTA
CATGTAGATACATGCGCATCGATACACATGCGTTGTAGTACTACATGTACTAGTGCAAAGTAATGTAGTAGTACATGTAGATACATGCGCATCGATACAC
ATGCGTTGTAGTACTACATGTACAAGTATGGATTGCAAGTCGAATACCACATGAGCGCGAAGAGCACGATAATCTGACACAAGCCCTGGTCCAGGTCAAG
CCTGTGGTCATGCCACACAGTAGAGCCAGCAGCAGTTTGGGCGCGAAGAAGAAGTGGCGTGCTTTTCGTACAGCGGTCCAAATCGAGCGTGAAGCTTCTT
GTCGAGCTGGTATTTTGGTCGAACGTCCTACGCCGGGAGAAAGAATTAGAGTTTGAAGTTTATTGGATTTTGGCTTGAGTTTATAAAGGTTCTCTTCATT
ATCGCACCGGGATATTGTTGTTATAAGCTCTTTGAATGACACATTATTTATTTAAAATAATGTTTTTGCTTTAGCCATAGACATATAACATATATTATGA
GGCCGATTTACTGATAGTGCAACGAGGTCCACGAGTTTGATCACACGATGAAGTCCACAGCCTCAACGTTCCAGCTCATCGTGAAGTTATCTTTAATCGT
ACAGTCCCGACTGCATGTGACTTACCCCCATCCTATTTGTGAAAGTGTCAAGCTGCCCACGTACAAGCTTTCCAGGGTCTATCTCGGAACTTCTGGTTGC
TATCGATTGCTGTACCGGTTTCTTGACTGTCAGACGCCCGCCTTCCGTCCTGTGCCGTTTCTACTATGAGTAGATATTAAATTGGCTATTTGTATTGGCA
CCGTTCGTTGCTGAAAACATTCGCTAGTTATCACGACGAGCAGCTCGCTCGTCACGACGCCTATTATCGCCATATCGACGGAAATCTCTTCGAACCCAAG
CAAATGGGATCGTCGTTGAAATCCAATCAACATCAACGACCTGGATTCCTGATTCGTCATAGTACGGAGCGCCAATTTGTCCTTCGTATTCGCCATCAGA
TAGCTCAATAATTGCATTGTCGTTGTCTTCGTCATCACTACGAGCTCCGTCGTCGCTCATACACACTTCCTCGTCCGTACGTTCCGGCGAGGAGCAAGCT
GCATCCATGTCAACAGCTCTCGAAGCTCTCCTACGAGTAGAAGAAGTAGTAGTGACACAAGCAGAACCACCCGAAGCTCGGTCATTAGTAGCAGGAATTC
GGTGTTGACCA