Description :
From Genome Similarity Track
Location :
Scaffold_13:37096- 41248
Transcript NameFunction/comments
Phyke_g920hypothetical protein PHYSODRAFT_533148
Phyke_g921hypothetical protein PHYSODRAFT_533258

Sequence
4152 bases(100 bases per row)
GTCGCCCACACATCAATCATAGACGAAGCCTGATGGTGCTCCTGCTTGGCGCTCTCCGTGCAGCAGGCCGACACGCCGTTACCGTTAGATTCTTGGCTGC
ACGTGGTGCCTGGCAATGCGCATCGTTGTCTACGCAGTCCAGCGGTGTGTTATTTGCTTGAATTAGTTACTATAAACGGTTCTTATTGAGGTGCAACAAG
ATGATGCTTACGTGTAAACTGTGGTAAATTATTTGGTAAACTGTCACGTTTAGTGTACACTTGGGGCAATGGCACATTGGGGCAATTGGGACACGGCCCC
GTGGTCAAAGCAGGCATCCGTAACGCGTACGAGGAGCTCACACCCAAGCTACTGGAGGCGTTCGAGGGCAAATCCATCACCCACTTGGAGTTCGGCGCAA
GTCACAGCGCTGCAAGTATGTTTTGTTTACCTACCTGTCTACATGCAGTGTACACTATTGTTACGGGTTTGTTGACCTTTTGGTTTGCCTATTGTGACAA
atgttgcagtcgatgaCCAAGGTAAACTGTTTGTATGGGGTTCCAACGAGTACAGCAAGCTTGGACTAGGCGAGAGCGTCgagattgaagagctccCAAA
AGAGGTGGAAGCGCTCAAGGGCATTAAGATCGTGGACGTTTCGTGTGGGGATTATTTTACGGCTGCGGTGGATGCTGAAGGCAAAATGTACTCGTGGGGC
TGGGGAGGCTCGACGATGAAAGGCGCAGGAGGTCTGGGCCATGCTGGAGGCAAGGACGAGCCGACGCCACGtctgctcaagacgctggtGGACCAGGGAG
TACCAATTTCTACGGTGGAGTGTGGTGAATTCCACACAGTGGCACTCACCAAGGACGGAGAGATCTGGGCTTGGGGCAATGGCGAGTATGGACGACTGGG
CAATGGCGAGTCTGATACGTGTGAAGTGCCAGAACCGATCGAGTTTTTCTCCAAGGACAACGTGGTTtctattgctgctggacggGACTTTTCATTTGCA
TTGACGGATAAGGGAGAGCTGTACAGTTGGGGTGGCAACAGTCGTACGTGCTACTGTGCTGTCTTTGAGGTTGAGTCCATGAAATTGATGGTCACTGATT
CGTGGGTATGTGTATTTTGTATTGATAGAGAACCAGTTGGGTATTGGTGGTGGCTTGGCCATGGACGTTTACAATATCGAGTCGATTCCTGTTCTGGTAG
AGGCCTTCAACGGCATGCAAGTGAAGCAGATCGCTGCTGGTTATGaccatgctgctgctgtgacgGAGGATGGACGTCTCTACATGTGGGGCGCCAAGAT
CTGGATCGAGCCGCATGAGATGACGGCTGTGAATGAGCACAAGATCGTGCAGGTCGCTTGTGGGCATAAATACACGGTGGCGTTATCGGACGACGGCAAG
GTCTTTACGTTCGGCAAAGGTAGTTCCAATTGTCTGGGTCACGACGACCGCAAGAACCAGTTGCAGCCCATGCAGATTCAGGCTCTGGCTGGCATTAACA
TCACCTCGTGCGTATCAAATATTCTGCCGCGTTATTTTGTCTGTTGCTGACTGATTGGTTTGTTCCCGGTTGATACAGGGTATCATGCGGCGACTACCAC
ATGGGCGCCATCGCGACACCTCACGGTGAGGCAGCGGACAAAGACTTTTCCTTCCGGGAGTAGGAGGCAGGACTTTCAGAGCAAACGCTCGGTTATTGCA
GGAACGTAAGCAAGAATGAACGTTAGCTGCTATGTCCAGCGTCAATTGTTCAACACCAAATGGACCCTTCATGTTAACGTAATGATTTCTATGGATTTGA
AAAGACGCATCGCGATCTTTTGTAGTCCCACAGGCATTTCGTCTGAGCTGCTATGATTCGCATGGTGTTCGTATGCGCGTCCATCGTGGCGTGGGTGCTT
CTGTGTGGTCCATTCCAGATATCGGAGAATCGGTGGCTATCTTTTAGCGGTGGGAGATCCCTGAGGGCTGTGTCAGTGCTCGGGCCAGCAAGCAGATTCA
AGTTGCAGGACCTGCTGCGGTGGTGGAATGGAAATCGACACATCACGTCACTGGATGCCTGGCCGGAACCGGAGGTCATCGTAGACGAGTGTTTGTCGCT
CTATCGCGATGCCAAACGCAATGAGATCTGCGTCATCAGCCGCTAGAGAACAGGGGAGAGCACTTCGGGTCATGAACTAGTGAAAAATCTATCGTTCTAT
AGTGTTTGCAGTATTTGGTTTAGTTTGCTTACTTGCCATcacgcttgcgcttgaggTTGTTACGACTCTGCATGACAGATGAGCCGGTGCCGTCAGAGGC
CACAACATCCGTCACAATGTACGGCACCTGCGCCGATTCGTGCGCAGATAGCAGCATTGTAGTGAGCGGGATACTACTGCGCACTAACAAGTTGACACGC
TTCAAGACAGAGATGGGAAGTGGACTGAGGATGAACAGTAGTCGCTTCTTCACATCCACAGCGCGAATGATTCCCACACCGACGCACGGAGGGTGCACTG
GTTGCAATACGATGCGCGGCGGCCCAGTCGCAACTTCGGATTCACCTCGCTTGAGCGGCTGGTGTTCGGCATTTATGCATAATCCCACGAGAGAGGCATT
CAATGAAAACAAGAGCTGGCTTGGTGGGACAGACGACCCGGCAAAAGCAATATCAACTTGGTCGAAAGACACGGCGAAAGGTATGAGTTGAGTGTACGCA
CGGTAGATATCACCATCGACACGATTCTTCTCCGAAAGCACGTGGAGATTTTGTAGATGAGTTCGCGTGAGGTCACATGGGGTGTGAGCCAAAAAGTATG
TATGAAGGCGATACAGCCGTAGTTCCTTGGAGCTCCGCGGGGGCTGTGACACACCTACAGGATCCCATGGCTGAACGCCGTGAACACGCCACCTTCCTCC
CGTGGGGACATCGAATTGCTTGTTTTTCGTTGCTGCAAGCATCTGCACAACGTGATCGGGATTTGTCTCCTGGATCACGTTACATAACAGGTCGTGGCCC
ATGCTCTTGATCCACCCGTCCGTATTAACCACCAGTGGAACACAAGTGCGTTGTGCATTCTTCGGGCTGCCATTGCTTGCGTTTGAGTAGGTGCCCCACT
TGCGGTCGTACAACCGCAACAAGCTTTTCACCGCTTTCATGTAGTACAACGGATCGTTGCCTGGATTGGTGTCACCGCAGAAAAACGACCGAATGGGGTT
TTTCATCTGCGAGAATCCTGGACCAAGCAGCGGCGTGGTCAAGGCatgaagagcaacaagaccGGGCGGCGTCAATTCGGACTGACCCAGGTCCGTGTCC
AAGAACGCCACCGTCCCAAAATGCGCCAGTAAACGGTTCACCAAATACCGACAAAACGTGGACTTCCCCACGCCTTTACCACCACAAACCACAATCTTTT
GCGGGACACAAACACCTTCATCCCTCTTCAATAGACTCGTTTCCAACCTGTCCACCGTTGCTTGCCAGCGTTCCGTGATCTGTACCGTCCGAAAGGAATC
CACAACTGCAATTTCAGCCAAAATGCGCTCTGGCTCCTTCCAGCTATGATCTAGTAAACGTGTATCggcaggtgcagcagcagtcgtgtCACTGTTACCC
GTAGCGTCGTTCAGCTCCTTTTGGGCTTGTTTTGACACAATCATCTTAAAACCAGGCAGTACAGCTGCAAGTTTTTGCGGCCGTGAGTTCTCATAGAAAC
TGGTGATATTGCCAAAACTCACAGGGATCGCTCGCAGCACTAGCACAATGGGGAAGTCCGTCACCAACTGCATCGCCAGTCGATCCGCAGcgatctcctc
gtcctcattgAGAGCCTGAGCTGGCAGCGTTGGCTCTGTAGCTTGCAATAGACTGAGGTTGGTAGGTCCAAATGGCGCTTGGCACTCTTCGTTGCCTGTT
CTTCCTTCAATAACCAGCAGATTGTTCCACTTGGGCGAATAAAGAGAGCAGTAGACGCCCAATGGAGGATGGTAGCCCAGAACGTCCACGGAGCCCTGGA
ACACACGGAGCAGAGCCATACCAGCGCAGTTGATATAAGAGTTTCTATGCATCCCAAGAGCGACGACATTGCCGGAGGGTACACAGAGAGCTCGGTATAT
GGGCGAGGTCGCACTACCAGTGACCCTGTCACTCCGTGAGCTGCTCGCCATC