Description :
From Genome Similarity Track
Location :
Scaffold_48:37093- 41129
Transcript NameFunction/comments
g9978.t1hypothetical protein

Sequence
4036 bases(100 bases per row)
GAGAACGCCTTGGGCCACCCCATCCCTGGCCTTGAAGTGCGCTTCCGCGACCTCGAGCTGTCGGCGGAAGTGCCGCAGCTCAAAAGCGGCAGCTTGGAAG
TGCCCACGCTCTGGACGCAGCTGCAGCAAGGACTGGGCAGCCTCTGCTCGTCCAAGGCGAACAAGCTCACGGTGGACAAGAAGATCCTGCGTGGCGTCAC
TGGTGTCTTTAAGCCTGGCCGCATCACACTCGTCCTGGGTCAGCCTGGTTCGGGCAAGTCTTCACTGATGAAGGTGCTCGCCAACCGGTTCCACATGGAC
AAGAACATCTCACTGAGTGGAGACATCGACTACAACGGCAAGGAGCGCTCGCTGATGCTGGATATGCTCCCACGCGACGTTGCGTACGTGAACCAGATCG
ACGAGCACTACCCTCGCATGACTGTCCAGGAGACCTTCGAGTTCGCTCACCAGTGCTGCTCGGGTCAAGGCTTGGAGCCTTGGGCCGTCGAGGCGCTGAA
GAACTGCACGCCGGAGCAACACGAGCATGCTCTCAAGGTAGTGACGGCGCACCATAAGTTTGCGTCGGACCTAATGGTAAAGAAACTGGGTCTGGACAAC
TGCAAGGACACCGTCGTCGGGAACGCCATGCTGCGTGGTGTGTCTGGTGGCGAACGCAAGCGCGTCACCACGGGTGAGATGCTCGTCGGCAGGAAGCGGT
TGCAATTACTGGACGAGATCAGTACGGGCCTCGACAGTGCAGCCACCTACGACATTTGTAAGTCGTTCAAGAGCGCCGCTCGCAACTTCAACGCGACCGT
CGTGATCTCTCTGCTGCAGCCTTCCCCGGAAGTGTTTGAGCTCTTCGACGACGTGCTGCTGATGAACGACGGCAGCATCATGTTCCATGGCAAGCGCGAG
GAGGCCGTGCCGTATTTCGAGGACATGGGCTTCCACTGCCCGCCGCGCAAGGATGTGGCCGACTTCCTGCTGGATCTTGGTACCAACAAGCAGGGCGTGT
ACGTTGTCGGCGCGCCGGGGAGTGTGCCGTACCATTCGGCCGACTTTGCCGAGCGATTCCGCGAATCGACCATTTTCCACAAGACGCTGAAGCACCTCGA
CGCGCCAGTCAAGGAGGCGCTTCTCATCCCTGATACCAAGCCCTTCCGCTTGTCCTTCTTCGAGGACATGACCATCCTACTGCGTCGGCAGATGATGCTT
ACATCGCGAGACACGACGTACCTCCTGGGTCGCGCCGTGATGAATATCGTCATGGGTTTGCTGTACGGGTCGACGTTTTGGCAGATGGATGACTCCAACA
GCCAGCTTATCCTGGGTCTGCTCTTTTCGTGTGCGATGTTCCTCTCGCTGAGCCAGGCATCGCAAGTGCCGACGTTCATCGAGGCCCGCTCCGTGTTCTA
CAAGCAGCGCGGTGCCAACTTCTTCCGTTCGAGCGCGTACGTGCTCGCTATGTCTATCGCGCAGGTTCCGATGGCCATCGCGGAGACTGTCGTGTTCGGA
GCGATCACGTACTGGATGGGAGGCTACGTTGCGCTTGCCGACCGCTTCATCGTGTTCCTCGTGACGCTGTTCCTGTGTCAGATGTGGTTCACCAGCTACT
TCTTCTTCCTGTCCTCGGTGTCCCCCAATCTCACGGTTGCGCAGCCCGTCATGATGGTGTCCATTCTCTTCTTCATGCTGTTCGGAGGCTTCCTGATCAC
GAAGGAGAACATCCCGGACTACTTGATTTGGATTTTCTGGATTGACCCCCTCGCGTGGTGCATCCGCGCGTTGAGCATTAACCAGTACTTGGCCCCGAAG
TTTGACGTGTGCGTCTATGAAGGCATCGACTACTGCACCACGTACAGCGAGACGATTGGGGAGTATAGTCTCGGCGTTTTCAGTTTGCCGACAGAGTCCA
TGTGGATCTGGTACGGCTGGGTTTTCCTGTTCGCCGGCTACTTCGTCTTCGTCTTCGCTTCGTACGTCATTCTGGAGTACACACGCTACGAAAGCCCTGA
GAACGTCGCGGTCGTCGTCGATGACGAAGCTGCCGAAGACCAGACTGTCTACTCGAAGATGCCGACCACGCCCAAGGCGGCGAGAGAGCACGAAAAGGTC
ATCGAGATCCAGGACGTGGACGATATCATGGGCGGTGTTCCTACTATCAACGTCCCGGCGGAGCCCACTGGCCGCGGCATCTCGCTCCCCATTACGCTGG
CATTTGAAAACCTGTACTACTCGGTGCCGATGCCTGGTGGCAAGAAGGACGAAGAGATTGACCTGCTGAAGGGAGTCTCCGGATTTGCTCTCCCTGGTAC
GATGACTGCGCTCATGGGATCGTCCGGCGCTGGCAAGACCACACTCATGGACGTCATTGCCGGACGCAAGACCGGAGGCAAAATCCAAGGCAAGATTCTG
CTCAACGGACACCCGGCCAACGACCTCGCCATCCGCAGATGCACAGGCTACTGCGAGCAGATGGACATCCACTCGGACTCGGCTACGGTGCGTGAGGCTC
TCATTTTCTCGGCCATGCTGCGTCAGGATGCCAGTATCCCCACGGCCCAGAAGATGGAGTCGGTCGAGGAGTGCATCGACTTGCTGGAGCTCGGACCCAT
CGCCGACAAGATCATCCGCGGGTCGTCCACGGAGCAGATGAAGCGCGTGACGATCGGCGTGGAGTTGGCAGCGCAGCCCAGCATCATCTTCATGGACGAA
CCGACGAGTGGTCTGGACGCGCGCTCGGCCAAGCTGATCATGAACGGCGTGCGCAAGATCGCGGACTCTGGTCGGACGATTGTGTGCACGATCCACCAGC
CGAGCACGGAGGTGTTCAACCTGTTCGACTCGTTGCTGCTGCTTCGTCGTGGAGGTCGCATGGTTTTCTTCGGCGAGCTGGGCAAGGACTCCCAGAACCT
GATCAACTACTTCCAGAGTTTCTCGGACGTGAAGCCGATCACACCTGGTTACAATCCGGCTACGTGGATGCTGGAGTGCATTGGAGCTGGCGTGGGCTCC
GGTCATGCGGATACCAATGGAAGTGCTGCTTCGCTTCCCCTGGACTTTGCCGAACGCTTCGCTGTGAGCGACCAGAAGATGTTGATGGAAGAGGATTTGG
ACCAAGACGGCGTTCTTCACCCGTCGTCTAACCTCCCGGAGCTCACCTTCGACACCAAACGTGCGTCAAACCCGCGCGTGCAGTTCCAGCTGCTGTGTCT
GCGCTTCTTCCGCATGTACTGGCGCACGCCGACGTACAACCTCACGCGTTTGTTCATCAGCGTCCTGCTGGGCTGTGTGTTTGGCATCATCTACCAGGGT
ACCGACTATTCGACGTACACCGGGGCGAACGCGGGCGTGGGTCTGATCTTCGTGAGCACCATTTTCCTCGGTCTCATCAGCTTCAACAGTGTCATGCCCG
TTGCTGCTGACGAACGTACTGCCTTCTACCGTGAACGCGCGTCGGAGACGTACAACGCGTTGTGGTACTTCGTGGCTGGAACGCTTGTGGAGATCCCGTA
CATCTTCATCTCAACTCTACTGTTCACGATTATCTTCTATCCGAGCGTCGGCTTCACGGGTTACATCACGTTCTTCTACTACTGGCTGGTGGTCTCGATG
AACGCGCTGCTGTTCGTGTACTTCGGTCAGCTCATGGTGTTCGCGCTGCCCAGTGTGGCCGTGGCGTCCACTCTTGGTGCTCTTTTCAGTGGTATCTTCA
TGCTGTTTGCGGGCTTCAACCCGCCGACGGGCAGCATTCCGACGGGGTACATGTGGGTCCACTGGATCTCGCCCCCGACGTACACGATTTCGATGCTGGT
GTCGCTGGTCTTTGCGGATTGCTCCGGTGGCAGCACGGATGGCATCAGTTGCCAAACGCTGCAGGAAGCACCGCCAACTATTGGCGACATGACGCTGAAG
GAGTATGTGGAGGAGACGTTCGACATGAAGCATGGGGACATCTGGAGGAACGCCTTGATCATGATCGTCTTGATTGTGGTCTTTCGTGTGTTGGCCTTGA
TCTCGCTGCGGTACATCAACCATCTCAAGCGCTAAG