Description :
From Genome Similarity Track
Location :
Scaffold_107:37091- 40043
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.30Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_107-fgenesh-gene-0.6GMP synthase [glutamine-hydrolyzing]

Sequence
2952 bases(100 bases per row)
TGCAGGTGGCCTACAATACGTTCATCATTGCGATGGAATACacAATGAACAAAAAGAACCCGCAGCTGCTCATCAAGATGACAATGCTCTACATTGAATA
CCAGGCATATCGAGGGGCGCTGTCCGTTTGCACATTACTCATTGAAGGGTACCCCCAAAGCAAACTGCTTCAAGAGGCCGTCTTTTTAAGTGCTTTGTCA
GCGAAAGCGTTAGGGAAGCACAAGGAGAGCGCCCAGTACTTTGCGTATCTGGTTGACAAGCCACCATTCCGGCTGTCAGGGTATCAGTTGCATCTGCTGG
CCGCATTAGAGCTTGAAAATGTCGACGGAATGCGCGACCATGCAAGAGAAAGCTATGTGGAAGCGTACAAACTGATGATAACGTTGAGCCCCGTAACATT
GTCCGAGAAGACGGCACATGATGCATATAAGACATCACACAGGAACGAGGGTCAACGTGTCCAGATGTGGTTTCAGGACGAGCGAACTTGGCTCGAGCTC
GCTACGAAACTTGCGAACCTCAATTTCCCTCTGTTAGTCTGTAGCGTGCTTAGAGTCATGCGTCGTCGGAGTGTGATAGTACCTCGCGAGGTTCTCATTC
TCGAAGGGATCTCACTCTATCGATTTGGTGATACTGAGAcAGCTGTGTCGGCTCtgAGCCAAGCGCTCCAAGAAGACTACtGGTCAAACCACGTTCGGCT
CTTACTTCGTAAAACCAGTAGCGCTTGGTGCCGTCAGTTTGATATCGAAaCaGCCAAaGCGTCCAaGATACAGAGTACAGTGAGGCGGcACCGAaTGCGg
AAGGGCTGGCGTGCTCTGGCGGTACGCAGTCACACACATAGGAACgATGCGAGTTCTGTGGTCTCACTACGTTTGCTTGTGGATCCAGAAACAATTGATG
AGTGAGAAACGAAGGATGGCTGCGACAACAATCCAATGTGCATGGCGCCAACGGATGTCACGTGAGAAAGTATCGAGACTCAAAGCAGCTCGGCGTGAAA
AAGAaGAACAGGAAAACACCACAATGGGGACGgAAGATTGGCTATTGATCATGCAGCAGCTGAACGCTGCGGCAATTCGGATTCAGTCGCTGTACAAGAT
CTTTCGAGCCAAAAAGGAaGCGCaTCTCCTGCGAGTCCTCACCGCAAAGCACGAGCGTGTCGTCGCGGCATTCGCAATGTATCGAGCTTCAAACAGCAGC
CGTGCAATCCTACGCATCTGGAGAGCATTCGTGAGCCAGCAGAAAGAGGAGCGCcaCTACGCTGCGAGTACCATTCAGCGACAAGTGCGATGCTTCCTTA
GTCGGCGGCTTTATATGCGGCTGCTTCAGGCAAGAGCTCGACAGCAAATGATCGTTGCGACTTGTCTCGACCGTCGAGGGAACACATTGAAGtGTCGAAT
GATGGCGGCGTGGCGTAaGTTTCTGACACAGAGGCGAGAGTTGAACACAAGGGCAGTCATGCGGATACAGAACGCCTGGCGGTGCTACGTGGGTCGCAAG
CGCTATCGCCATGAGCTACGACGCCATCTCATCACCACGGACCTTATGCACAAGCTACTGGGAgagaaaCGCCAAAAACATCTCCGtGATGTGTGGAATG
CGCTCACGACAAATGCAGTGTGGCATCGCCTCAGGAAGCGCCGgaGTGCCATTGTCATCCAGCGACACGCCAGAGGCATGATAGCTCGTCGTCGTGTTCG
GAAGCTGCGATCGAGACGCcGCCGTGTGGAGGTGGCACTGAACGCGATGCGAGCCAAGTCGGTCatGCACCAACTGCAGCTGGTGTTCGACGGCTTCGTT
CGGTATGTCGAAaTgcAATGGCAAACGAGAGAGCGTTCGGCCGTGTCCATTCAAAAGATGTATCGCGGCCATGCTGCCCGTAAGCGCGTTCGCTTCATAT
GCGAGTGCAATCGCATCCTCCAGGAGCCAGGGATGACTCTACGAGGGAAGCCCGACGCCTACGTCCTGCGAGTGTGCTTCCTCCTCTTGGCAAGACTGCC
GGAACAAAACAAAATGGACCGAGAACACGCTGCACGCAGACTCCAGAAGTGGTATCTCCACGCCCACAGGCGGCGGAGGCTGAAGCGAGCGCTGCAGAAG
CTACGGCGTCAGCGTGCGATCCTCAACACGCTGCAGGCGACGTTCCAcTCGATAGCGCGTCTTTTCTtCGTGGAGCTCAAGAGCCGGATGCAAGCGAGGC
GGTGGcGGCAGGACCGAATGGCCCGACGGATTCAGAGAGCGGCGAgaGAgtGGCTGACGTATCGTCGATACCAGCGTGTGCTCGACCAGAGAGCGAGTCG
CAAAGCGCGAGCACAAGACCATGCGCGCCAGAAGCAGCAGGCGATGCAAGCCAGGTGTCTTCTGGAGTGGCGTCGCGTCATTCGTACGGAGAAAGAGGAG
CAGATCGGAGCCGTGTGTCGTATCCAGAGAGCCTACCGAGCTCGTGTTGCCAAGAAGCAGGCCCGTCAGGTTCTTCACAAGCGCGCCGCACGCGCTCAAC
TGCTCGAGTCGATGCACCTCAAGCCCCTCGAGCGGTGCTTCCGTCAGTGGGAAGCGTCTCGTATTGAGAAGAGCGTGTTGACCGTGCGATCTGCAGCGAG
AGTATCGACATCTCCGGACAAGTGGCGACTGGGCGTGAAGACGCCGCAGAGACAAGCGGCCGCTTCGTCACTGACACTGGAAGAGGTACGAGGTGTCTAA
CGGAGTGGACTGCTAACCCATCGACTGACGGCTTCtGTAGCGAGCAGTGCTGCCGTCGGTACTCTTCTACACGCTGCTCAACCGTGTTCGCACCACGGGC
ATCCTCCAACTCTCGTGAGTGCTGCTTCTCCTCGCTTTTAATATTCTACTGACTCCACTGCTGTgCCAGCAGCGGACTCTCTTGCTTCCCTACCAATCAG
CTCCACCAGCTCCTCGCGTATGCCGTCAGTGTGATCGTCGATGGTGgCGGCg