Description :
From Genome Similarity Track
Location :
Scaffold_252:37089- 38954
Transcript NameFunction/comments
Hyaar_Emoy2813199hypothetical protein

Sequence
1865 bases(100 bases per row)
TGCCTTGTACTTATGTACGGAACAACCATATGGTCTGTTGCAAACCACTAGAAGTGAAACCTAGCATTATGAAAGGCAGACATTCATTTTATGGTGGTGG
AGTTTTCGCATTTTTTGGCAAGGAGTGAAGTATAAAAACCAGACTTTTTAAGTTATATTTGTGGACCGCTTGCTTGCGACGCCAGTTCTATCGAGGATAT
GCGGTTCATTTTAGCTGTCGCATGGTCTGAGTGTACAATTTTGGGCACTACCAACCCCAACTTTGATCAGCACTACACGGGTCATGCACGGGGTCATGCG
CAAGGTTATCCATACAACCCCTAGCTTGTCGTTTGGTCCTTGCATACGTAATTGCTGCTCATTTCCACCGCGCGCAGTGCTCAAATTACATACATTGTAA
CGGGGCAACAATCGCTTGTACTGTCACAGTACAAGATTCTTACACCGAACAAAGAGTAATTAGGTGCCTCGAAACTTCACGTACACATGTCGTACAGAGG
AAGGTTTAGATACGAGATAAGGGTAAAAGTAGAAGTGTATTTTGTATACTTAATCTTCTGTTAATAAATCCTATTTAGTCATCTTTTAACTAAACCTAAA
TACAAATATAACGATCTGCTCACCACTCATCGCGTTCTTCTGTCGTGGATCGGCTTTATTGGCTGATATCATTGACATAATAAACATATTATGACTTCTG
CATTACAATATTATTTCATAAGCTAATATTGTGAGAATATGATGTCTAACATAATATTCACACTTGATATTTACCTTACGTAAAGTATCCTATAACGGAG
GCACCCCATTACATCACTTCCCCTATAACATCAGTCAGATTAGTGACTGATTGATGACTGAGTAAATTTAGGACAGGGAAGCACTTGTTGTTTTATTTTA
ACCATTCCCTCTTCTCATCGCAAGGTTAAGAAGTCCATGCGGTGCGCGGCCAAGGCTGCCGGGAGTGCAGCAATGAGATTACGTTCTCCAGACGCGGAAG
AGGCAAAGACTTTAAATAAAGCAGGCGACAATTCGCCTGCTGCTTCCACTACTCAGCCTGAAGCAGTCGTTTTTTGTAGGCTCACGCGGTGATCCACCGC
GTGATATAAGCTCGAGATCATACACTTCGGCGAGTTGGATAGCGACACCGACTCGAAGAAAACAGTCGGGAAGACATAGCCAGACATGGCCATGCCTTAG
TCGACCAAGTCGGACTCTCGAAGCGCTAGGATCCTCCTTGAGCGTCGTGGCATCTTCGGATAGTCCGAAGAGTCGGACGATCCGTCTCCGAGACGGAGTC
GTTTGCTCAATAGTGATCGAGGCGGTGGCTTGGTCCATTTTAATGACGGTGATGCAAAGATGCATCACGATCAAGAAGATCGTACTGGTCGTGGTTTCAG
TACTTCTATTAATACCATGCAAGAAGCCAGACATCGCGGCATCTTGCGCGTCTCTCCCGAGAAAAAGGCGTGGCTGCCTTCTGATCGAGTGTTGGATTGC
TTGTCCGACACTGTGAACGGTCGTTATAGGATAAGAATATTCGATTCATCAATACTTCATAAACTTGACTCCAGTGCGAGTGACTTTCGCACTGAGCATG
ATTTCTTCGTCACTGTTGTCTTTAAACATCGATGGTATAGCAAGAACCATAAACGTGATGGTGAGTCGCTGACCCAGGCATAAAACGCGTTTATCCACAA
TTTTGGGGAGATTGGACGCGATGCCTGGCTTGACAAGCTGACCTTATTGCGCAATAGGTATGAAACGCGGACTTCGACCGGTGAACGTTACCACCTGTAT
CGCTTATCGAGAGAGGCCGGGTTACCATGCCTCTCCTGGGGTGATGCGTGCCAATGTTGTGTGAA