Description :
From Genome Similarity Track
Location :
Scaffold_724:3708- 6322
Sequence
2614 bases(100 bases per row)
GCTCAGCCAACCGTTTGAGCCGCCAAGATCTAAGTTCAGGACTCCATCAGAGCTCCTGAAGATAAAACAAGGAAAGAGTGACGTTCACGCTTACGCTCAG
CACGTTCATTACCTTGTAAGCTGCATGGTAGCGAACCCTGTAAGTGAATTCGTGTTGGTCATGATATTCTTACAGGGCCTTATAGATGGTCCCGTGAGGA
ACCACCTATTCTGCATCGAGTTGAAGTCGCTTGAGGAAGCGATTACAACTGCGTTGCAAGAGGACTTTAGTGTGAGACAGGCTCACACTAGCTTGACCCC
CTATCGTCCTTCGAGACGAGTAGAGGCGGGAGGTCCAGAATCAATGGACCGCTGCAGTGTCGAGAGGGAGAGACCTCGCTCTTCAAGCAGTAAGTGATTG
CAAAAGTGCAATCGCTGTCAGAAGTTAGGTCAATACGCCTACGAGTGTAGTGCTTCACGCCCAGTGTCTCGAAACACTGAGCGAAGTGATCGACCGTCTG
CTAAGAAGCGCAACGGATGTCCGACGCTATTGCGAAGTCAGAACAGCGTGGCGGACGGTAAAAAAACGGTCGGGGTCAGTAGGGGCGGAGCGCTACTGAT
CCAGCAACCTCAATATAATTTACAAACCTATTGATGAAAGTTGCTCCAGACTCACAATCCTTTTGTGTCTCTGCACTTGGTGATGAGGTACCCCTCATAA
CCTTGAATTTAGAAGTGACAAAAGATTTGTCACTTTGTGCCTTAGTGGACTGTGGGGCGTCGAACATCTTTGTTTGTCACCAGTCGCTAGACGATCGTAG
GATCAAGTTCGTTGAGCGCGTTACTCCTCCTACAACGCTGACGGTGCGCCTCGCAACAGGCGCATCTATAGCAGTGATGAAACGTGTAGTGGGATTTCAC
TACACGTTATAAGATTTGCAGCACAATGATGATTTCATCGTACTTGATTTGGATGACATATTTGATGTCATCCTGGGATTACCAAGGTTCAGAAGGTACG
AGCCAAGGGTCAGCTGGCAGCATAGAACCGTGAAGATGTCCGCCACTTGTTCATCAGATGGCCATCTGATGAACGTCTTGGAGCGTCCACAAGCGTGTGG
ATGTACTGCGAGTGATTGCGATGGCCTCACTTGCGATACAGTCGTTAGTACGACTGCACAAGATCACAGTGTGACGACCAATCACACTGTGGAGGAAGCT
GTTGGCGGCTGTGCGGATGCATAGGCAGCGCCGAAGGTCCACCACTCGAATAAGTCGAGTGGATCGGGACGTGGGTGTACGCCTAGAGGGCGACATCCTA
GTAATAAAAACCGGTTGCTTACACAGGGCAACACGATGATCCTAAAACGACTGGAGAGTCGATCGTAGAGGACCTAGCTGTGGTAGCGCAACCACAGCTA
GAAGACGTCGAGGGAATAAGCCCCCAGTAGGCTGTGGAAAAAGGTTCCCAGGAAGAAACCGAGACATTGAATGTCTTGGTTAATGACGGGCCAAGTGTAG
GCGCTTATACACTTAATCTGATCGCGCCTCCGAATAGACTTCGGAGATCACTAAATTGCCAACGCTAGAACCGAAACGGTTTTTGCGAGATCTGCGTAGT
GGCAAGGTCAAGTAGTTCTGTGTACTCGTCACGAAGAACGAGTACGTGACTGATATTCGGTCGGCAGTAGTATTAGCAGAGAACGAACGGGTTCTCAGCA
GCTTATCAATGGACGAAAGTGGTCTCGATGAGAAGACTCGGATTGAACGATACACGGCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTTTAAAGGGT
TTGATCAAATACAAGGACGTGTTCCCTGAATCCGTACCATGCGAGTTGTCCAAGGACAACGGCACTCAACACGAGATCGAGTTCAAACTGGGCTCGAAGT
ACTGTGTCATGAAGCAATGGCCACTACCACGTGAACAAGTTCTTGCGATCGAAAAATTCTTTATTGATCGCTTAGCTGCGGGTCATGTGAGGGAGTCAAC
TTCCCGTCACAGATCTCCGACCTTCTGTGTGCGCAAAGCCACAGGAGGATGTCGGATAGTGCACGCATTCAACAATTTGAATGCTGCAACGGTACTGGCT
CAGACGCCAATACCGAAGAAGGACGTAATCATTGATGGTATGTCAAAGAGTACCATGTTTTCGTCCATGGATCTGATGGATGGCTTCTATCATATCCTAG
TGCATGAGCGGAAAATCCGTACACGGCAGTAAGAACCCCGAGCGGTATGCTCTGGGAGTGGCTAGTAATTCTACAAGGGCTTAGTAACGCCCCTGCCACC
TTCTCAGATGTGTTACAAATCTGTTGTGGCCAGTGCGAGACTTCTCACCGAGTTAGTTCGACGATGTATTCGTCCATAGCCGGGCTATGGGCGAAAATAG
AACGTAGAGGTTCATAGAACACACATTCGTCAGTTTCTTACACTTATGTGCAAGCATAAGCTGTATGCCAACCTGAAGAAGTGCATATTCGCTGCTAGCG
AAATACCACTTCTTGGGTGCATCGTGGGTAAACACGACGTACTCCTTGATCCTGAAAACATCAAGGCGATTACCGACTGTAATTTTCAGTCGCGTAAGGA
CTTAGAGAGTACCT