Description :
From Genome Similarity Track
Location :
Scaffold_1944:3708- 5694
Transcript NameFunction/comments
Phypl_g14437hypothetical protein

Sequence
1986 bases(100 bases per row)
GTACTCCAAGCGGTATGCTATGGGGATGGCTGGTGATGTAACAGGGAGTGTAGAATGCTCCAGCGACGTTCAACCGCTTGGTCATGCAGTTGTTCCGACC
ATTGCGTGCGTTCACGCAGACATACTTTGACGATGTGTTCGTCCATTGTCGTGCCCAAATTGGCAATACGGCTCTTGAGGTGCATTTGGTGCACCTCCGT
CAAGTGTTGGAGGTCATGAGAGCCAATACGCTATATGCCAACATCGGCCGGTGCGTGTTCGCGGCCAAGGAGATCCAGTCCATATGCTGCTTTGTCGGTC
GCGCGGGTGTGCGCGCCGACCCGGAGATGGCCAAGGCCAATATGGCTTGGCCGACTCCCAGGTCACAGAAGGACCTCCGGAAGTGGTTGGACTTGGCCAA
CTACCTGCACAAGTACAGTGCTGGGGACGCCAAGATGGGTAGACACCTGTCGGAACTCCTGAAGAAGGACGTCGACTGGTCATGGGAGCAGTCATACCAA
GGTGCATTCGAAGGCATCACAAGGAGCCTCCAGAGCGCTCCTGTCTTGGTATTGCCTGACGAGCCGAAGGCGTTCAGTGCCGTCTGTGACGCCTCCGACT
ATGCAATTGGTTGCGCGTTGCTGCAACCGGACGATGAGGGACACGAGCGTGTCATCTCGTTCCAGTCCAGACAGCTGAATGTTGCGGAACAAAACTACCC
CGTTCAGATACGGAGCTACTTGCCATGAGGTACGCCCTAGTCAAAATTAGTGGGCTCACGGCTGTTTGTGATCTTCTCAGACCACGCGTCCTTGCGGACT
GTCGTCCACTCACCGCATTTGTCGCAGCGAATGGCCCACTGGCTGTTTTTCTTCGCGGAGTACAACATCCGCGTCGAGTACAAGCTTGGCAGGACGTGCT
TGTGGACGCGTTGTGCCATCGACCCGACTATGAGCTTGCACACATTAGCCGGCTCACGGCAGATCTGTACAATCGAATACGAGAAGCGTATCAGGGGGAT
GTACACCTCCCCCACCCTCCCCCCTTGTACGGCACTTCACCGCCGGAAAGGATGCCAATTCGGATCTGCTCTCGCCTCGGCAGCAAGGCCAGCTTCACCG
CTATGAGTTGATGGGTGGCTTGCTCTACTACGAGTAGAGTCATCTGATCCTCCGAAGATCGTTGTTCCCAACGATGAGGATCTGAAGTGCGATATACTTC
ACGAAGTGTACGACGTGCGTACCAGTGGCCATCTTGGTCGAGCGATGACCTACCATGCGGTCTCTCTGACGTTTTGGTGGACGCACATGTACTAGTGGGT
TGCCAAGTACGCCCGGACATGCGCAACATGTCAGCTGGTCAATCATGCCGGCCACGCATCGGCTCCGTTGCAGAGCCTGCCAGTGCCGCTGGACTGCTAA
AAGTCGATGAGCCTCGACTTTGTCTTTGGCTTTCCAGCCGACGACCGCAGAAACATCGGTATTTTGGTGTTTATGTGCCGTCTGAGCAAGATGGTGCACC
TTGCTCCGGTTCCCGACACGACCACCGGGGAACAAGCCGCGAGGCTGTTCCTGGATTGCGTATTCCGCTATCACGGTCTCCCGGAGGCCATCATCTCTGA
TCGAGGCACGCGGTTTACCGCTGCCTTTTGGAAAACGCTGTTCCAGCTACTTGGAACGAGGTTGCTCATGTCAACTGCTGACCATCCCCAGACGAACGGC
CTGACGGAGCGCGTTAACCGCGTCCACCAAGACGCACTGCGCAGTGTATGTGCTGAGGCGGCGAGCACGTGGGCAGCACGGCTGCCCACGGTTGAGTTTG
CACTCAACAACAGGTGCACGCGTCAACTAGATTCTCCCCGTTCTACTCGAATGGGATCCGTCACCCCCAGGTGCCGCTTACTTTACGTGGAGAAACTGAG
TAAGTGGGGGAGAGGCTCGGAAAGCTCTTTCCTCCTAGGTCTCTGAGGTGAGACCGGCCGCATTGAGCAAGCAATTGACGTCGTTT