Description :
From Genome Similarity Track
Location :
Scaffold_15:3708- 5059
Transcript NameFunction/comments
g3066.t1hypothetical protein

Sequence
1351 bases(100 bases per row)
TCATCTCCAGCTTGCATAGCCTGGAAACGGGCTCTTGCGCGCGCACCTTGGTTGAACTCGTATAGTAGAGCACCACAGTTAAGCCTCGACACAGGTAACC
ATTCCGTTTCATCGTAGCCCTTCCATTTCACAAGGTATTCGCGAGAGCGCCTTGATGTCCGAGTTCTCTTAGTCCAGCGTAAATCTAGGATTCGCTCGAC
TTCATACTCGTCATTCTCTACGTCAGGTTCCCAGCTGTCTTCTGGTAACAAGGCTGCGTCAAAATCGTCATCTTCCTCCACGTCTATTTCCACAGCGGGT
CGCTTTGGGAACAATGCTCTAGGCTTTAGTCGACTCACATGCACCCAGGGATTAACACGATATCCTGAGTTCTCAATCCTGAGTTTCACTCTGAAGTGCA
TTTCCTGGATACGGAATGGACCATGCCACATGTGAGCTAGTTTCCGGCTGAGTCCGGGCTGCACCTTCGGTATATATAACGAGACAGCATCGCCCACAGC
GAAGCCAGCTCTCAAACGTTCGGACAGTTCTTTCCATTTCCTGGTCTGCTCAGCAGAATGCATGCGTTTAGCCTTCTTTTGCAGGTCTTTGGCACAAGCC
TGAGCGTAGCTGTAATCACGCTGCAACTTCCGACGCCTGTCATACGCAGTGCGTTCCTGGACGCTCGACGGCTTGGGTCCAAGCATAGCAGACACCGTAC
CGTGTGCGTCCCAGCCGTGCACCAGAAAGAAGGGGGTATCCAGTCTCGTTGCATCAAATGACGAATTGAGAGCGAACATCAGTCGCTCTGCATGACCATC
CCAGTCACTCTGGTCGGCTTCCGCAACGTACGCGCGGATGCTTCGCACCACAGTATGCACAGATCTCTCCTGCTGGCCGTTGACTTGAGGGCGATACGCC
AGAGTGGCTCGCTGGTTGCTACCCAAGAGTTCCCGGAATCGCGTGAAGACCTCACTCATGAATCTTGGATCCTGGTCATGTCTTATCATAGAACTCGCTC
CGAACCTCCTGAATACGCATTCTTCATAGACTTCAGCGACATCTTGGGCCGTCGTAGAACTCATGGGTTTACACATCACGAACCCCGAAAGCATGTCCTG
GAATAGGAGCAAAAAAGTGTTTCCGCGGTCCGACTTAGGCATGTGCGTCACAAAATCCATGGACACAACCTCGAACGGTCGTCTGGGCTCAATGTTTCCA
GGCGAAGGTCCAGGATTTGGAGGACGCCCCTTGCCGCTGGCGCAATCTACGCATTCCTTGACGAATTTCTCAACATCGGCATACATACCGGACCAGTAGA
ATTCAGAACGAAGCTTCTCATACGTCCGCGTGATCCCTTGGTGTCCACCTT