Description :
From Genome Similarity Track
Location :
Scaffold_38:370727- 375358
Transcript NameFunction/comments
Phyra_95362arginase
Phyra_48183pyridine nucleotide-disulphide oxidoreductase domain 2

Sequence
4631 bases(100 bases per row)
GAGCTGCCAATTTTCATGTGTGTAATTGTGCGCGTTGGGACAATTGAGTAGCAAACGCTGAACGACACGTTGCTGGTGCTGGAACGCAATATCTTCTTCA
TCAGTGGATGGGTGCCCTACTTTGTGTCGCTGCAGGAGGATAGTATCCTCATGTTCACTAGCCGCGAGCGGTGGGAACAAGGACTCAAACCGGACAAGGT
GATGGTTTGTGTTGGGTTATGTGGCCTAGTGTTTATTCTCATTTTGCATCTCTTTCTGTTTAGGTGATTGAGTTGCACCACATGATGCTGCTCGGGGACA
TGAAGGTGGATGTGGTCGAGGGATACACGTCGCTGCATGATACCGACGGCAGCTTGCGACTTTTTCGCCGCAAGCTGTTAGAAACCGACGAGCTGGACGA
GGTAATCCGTCTTTATCAGTACCTCGTTATCTTAATTTTCCACTACACTGATGTTGTCATCGACTCACTAAATGTATTGTTTTGTGGGTTGAATTGTTAT
GCGTAGTGGGTAAATGAAGAGCTCCGGCAAAGCCTAGTTGTGTCCACGGGCAGCAAGGTGGACAACCTTGCTGTTAACAATCCGAACGCGAGCACTCACA
GCATTTTGGAGTTCAGCTCCTACAACCAGAATACGTTCGAGTTGTGGACAAAAGCAATTCGCCATATTCTGACCCTCAAACGAGAAATCCATACCAGCAG
CAATTCACGCAGCAACCAGAGCAAAAATGACACTGATTCTACGTCACCAAGGTCATCGAAAAGGAGCTGGGTATCTCCAGGACAAGACTCGAAGGTGACT
CTTCATCAAAGTGAAATTTGGTGCCACCGGGTTCTATCTGGTGAGAAAGAAAAAGCCGAGTCAGAAATTCGGCGGATAGTGGCGATGGAGAAGCTGGTGG
CTCAAGTCACTCACCCAGCAATGGCCTTGTTGGTGTACGAGAAGGTGAGTCGAGTACACGAATTATTCTCGGCCAACTGTAGACGAGAAATTGAGCGGCT
TGACGGAAGAGAAAGCCCTATGTCAACCGAGGTGCTTAATTTCTTCGCTGACCATCTTAAGAGGAAGTACTCCGTCTTCCTAATCCTTGCGTTGGCGTAT
GGGGTGGAAGAGGAAGAAATTCGACAGGCGCATGAGCGGATGTGTCATGAGAACGCAGCAGTGAACGCAGGGGTTGGTGGTGGCAGCGGGGAGCAGCAAA
GAACTGTTGCTTCCTATGGCTTTGAAGACCCCGAGAGTCTCGAGCTCTACGAGAAGTACCGTGATGCAGCACTCAATTACCATAAAATGAATTACGGGGA
CACGGCTGCAGCAGAAGAAGAAGATGCCATCATGCACCTCCCCGTCATGCTGCAAGTTGCGGTTGTTCGACAAGACCTCGAGGAGTCAAGTGCGATGCTC
TCCATCTTGAATACTGTCAAGGCTCACTTAATGGAGCATTGCACCCAGGAAAACGACTCCTAGTGCGAATGCGTGCTTCACAAACCCGACGCACTATCTG
CCGTGGTTCCAGTATTCTTGTGTACTATGTGCATGATTCAGAATATCTTCCGAACACAGAGTAGAAAAATGAATGTCACTTGATCCTCCGTTAAACGCGT
GCCGTGTAACTCGTCTCCTCATCAACCAGCCAGAATGGCATCAGACAGAATTGTGTCGATATGGTCGTGAATGTCGTGCACTAACTGCCGGAAGCGTGGG
TTGTTCATGTAGTGTTTCACCAGTCCTTCCACACCGCTCTCAATTTCTTCCTCCGTCTCGGCAGCAATTGCCTCTGAATCCTCCACGAGAGGATCGATGT
CTGGTGCAACGCAACGCAACATCAGTTAGTTAATCAAACCTGTCATGCAACCATCAGCAGCTAACAAACCCCAGGTCTCCATCATAGCTTCCGCAGCTCG
AAGTGCTTCATCTGGATCATAAAGGCGAACCCTTCACATACACAACAGGTAAAATATTTCCATTCGTTCCAACACACAATATCCGTTCACTTTATTACGT
CAAGCTGCCGCCGCTGTCCACAGCAACACGCAGCAGCCTTCCTCGAACTCGCGCGCTCTTGATGTGGTTTTTGGTGATGCTGATCAATGTATGACCGGAG
ACCGTCGGTGGTCCCAAAGAAATCCTCAAGCACCGGTCACTCACAGTCATCGTGAAGCGTTTACGTAGCGCCTGCAGCCCACGACGTGCCCCACTCGCCC
TCCGTTGCCGTACGATCTGCACCTCGAACGTCTCCATAGGACAACTTTAACTCGTAGCGGGTCAGACATCCCACCCGTGACCATCACTCTGATATTGAAG
TTGATTGGATTGCACACAGTGTGCTTCCCATCGCCATTCCGCAATTTCTCGCGTAGGACGAAGAAGCCGCGAGGATGAAGGCTGCTGCATCGCTACTACG
GAAGAAGTGGTGAGCTTCTAGAGGGTTTCGCACGTTACTTTGCATTGTCAATCGCTCATCATCTGTCATGAGGGATGCCATCGTCGTGGGTGGAGGCCAC
AACGGGCTCGTAGCTGCCGCGTACCTGGCGAAGGTTAGTGATGTTTTTCAACAGAACAACTCATAGTTAAGCTGACAACTGTCGCTCGATGCCCAGGCCG
GGAAGAGTGTCTGCGTGCTGGAAAAGCGGCATCTTGTCGGGGGTGCAGCGGTGACGGAGGAGATTTTCCCTGGTTTCAAGTTTTCGCGAGCTTCGTACGT
CTTCTCGCTCTTCCGCCCGCAGATCATCAAGGACTTGGATCTGCACAGACACGGACTGGAGGGTAAGTGTACGTGAGCTTCTGGTTACCATGAAGTGCTC
ACTTGGCTCTGTATCTGCAGTTTTTGTTCGGGACCCATCGTCGTTCACACCGACGCGTGACGGTCGAAGCCTCATTCTCGGGAGTAACATGCAGCAAACG
CAAGCTAGCATCGGTGAGATGAGCATTGTGCGTGTGGCGAAATATTGAGCTGATGAATTTGTTGCCCCATTGATTTGAGAAGCTCAATTTTCGGCGGCGG
ATGCGGAAGCGTATCCTGCGTACAACAAGATGCTTGAGGTGATATCCGATGAAATCTGTATTTCGTGCTTTACAAATAATAGTCCGGCCTGTGCTCACAT
TTCTCTTGCTGCAGGAAATGGTGGATTTCTTCTTACCGATGCTTGATGAGGTTGGTATCAGTCGCTTCTTTTAGCCTGTCTTGAGTTCTCATTTTGTTCG
TACTTCCGCATGGTGCCAGCCCCCTCCGGATCTCCACACAGTGTTCGACTCCAGTGCTCCTCTTCGGTAAGATTTGCTTCTCGTAAATGAGCTTGTGATG
CGTGATGTCGTGCTGATATCGCAAAACTAGCCGGCGTTCCGATGCAGTGAAGGCTATGGCACGCTTGGGTTATCGCTGCGGTAAACTCGGAACCGATTTG
ACTACTTTTACGGAATTTATGGCAGCGCCCGCGACGAAAATCCTTGACAAGTGGTTCGACTCAGACGTGCTCAAGGCCACACTCGCTACAGATGCCATTA
TCGGTGCAAAGGTGATATATTGCGTGAGTTGCAATGACAAGTTTTCGTCACACTAACTTCCCGACCTCGCTGAATTGAAGGTTTCCCCTTCAACTCCTGG
ATCAGCCTACATTCTTTTTCACCACGTCATGGGAGAAGTGAATGGCATTAAGGGCGCGTGGGGGCATGTAAAAGGCGGAATGGGTGGCGTTTCCCAAGCC
ATTGAGAAGGCGGCGACTGAAGCGGGTGCCGAGATTCATGTCAGCACCCCTGTCAAGTCGATTAGTGTTCATGACGGAAAAGCTCGGGGTGTCTGCCTCG
AGAATGGAGATGTCATCGAATCAGACTACATTTTGTCTAATGCAAGCCCAATCACAACGATGCTGGCCCTGCTTGATACAGGGGAACTGCCAGCAGAGGT
TATCACCCATTTCAAGCGAAACTGGAACAGTGAGTCTGCCTCAACCAAGGTAAACACTCATCGAATCCCAGTTGATGTGGTTTAAATCGCTTTTGCTGAC
CTGCATTCCTAGATCAATGTGGCTCTCGATCACTTGCCGAATTTTTCCTGCTTCCCGAATACGGGAAATGGCAACACGCCGATGGCGAACCACTACGGCA
CAATTCATTTCGAAGACTCACTACAGCAGGCATAAACTGCAGTGCGGCGAGCCACATACTAGCCCCTGACCAAGCTGTGTGAATTATTTTTTGAGCAGAT
CGAAGATGCCTTCTTGGACGTTCAGCGTGGAATTTCCTCTAAAAGACCGATAATTGAGATGAACATCCCGACGTCGTTAGACCCCACCATTGCTCCACCA
GGTAAAGCAACAGAAGTTGGTTCTTTATGAGTTACTACTCGTTTTGGAATTCGAAGTAGTACTTACTTACGCGAATCTGCTAACGTCGACAGGAAAGCAC
ATCGCTCTTCTCTTTGTGCAGTACACGCCGTACGAGCCAAAGGTAAGAACAAACTTGTTCACCCTGAGTTGTATTAGCAGTGGACGCTAACGGTGAAAAT
CTGACGCTCATTTATTTTATAGCACGGGAAATGGAGCGATCCAGGCAAGAAAGAACACTTCGCGAACCAAGTTTTCTCCGTCATCGAGGGGTATGCCCCC
GGTTTTACGAAATCGATCGTCAACTACGAAA