Description :
From Genome Similarity Track
Location :
contig_24:370710- 371798
Transcript NameFunction/comments
g4588.t1hypothetical protein F442_04360

Sequence
1088 bases(100 bases per row)
GCTGCGGTGCTCTCGGCGCTGCTGCTGCACCCTGTCGAGGCCGAGCAAGAGGGATGTCACTGCAAACGAACCATGAAAGGCCGTGAGCACTTGCACCCGA
AGGTGCATTCGCTGCCGGCCTTGTCGCTCGATGAATCGCAGGAGATCGAGCACCTCCCCGCGCATTTGGACTGGTGCGAGCGCGGCTTCTGCGTGCCCAG
TTGGAACCAGCACATTCCGCAGTACTGCGGCTCATGCTTTGCTCACGGTGCCATGTCGAGCGCCCAGGACCGCATCAAGATCCTCAACAAGCGTCGCAAC
TACACTGGGGCCGACGTGATGCTCGGCCGCCAGAGCTTTCTCAATTGTGCGCCAGGCCACGGCCTCTCCGATGGGTGTGACGGGAGAAGCTGTCGACGTG
TACGAGTTCATGCGTCAGTATGGACTGCCGGACGAGTCCTGCCTGCCGTACAACGCGACGGACCACACCAAGTACAAGGAAACCAACGGCACTTGCCCAC
CGAGCGGATACTGCATGAAGTACGTGAGCTTTTTGCCTGAATTCTGGGTCATGAGCATCTCAAGTTACTAATTTGTTGTGCGGTGCAGCTGTATGTACAC
TCCGCAGAGCAAGGCGGTGCCTCAGTGCTTCCCGGTGACCAAGATGGTGCGTTACCGCGCCAAGAGCCACGGACACCTGTCGGGTGAGCTGGCTATGATG
AAGGAAATCATGAAAGGCGGCCCCATCACTTGCGGCATCGCGTGCAGTGAAGAGTTCACGTACGAGTACAAGGCTGGTATACTGGAGGACAAGACGGGCT
TCATGGACATTGACCACGACGTGGAGATCGTCGGCTGGGGCGAGGAAGACGGCGTCAAGTACTGGCACATCCGCAACTCGTGGGGCACGTACTGGGGCAT
GAACGGCTTTTTCAAGATCGTCCGCGGCAAGAACAACCTGGGCATCGAAGCTGATTGCGCTTTCATGGAGCCCGACATCAGCGACGAAGAGCTCGTGTGG
GAGGAAAGTCCGTGTATGGAGGCTCCATCTTCGGCATCGTCCCATTCAAGGAGACCGCGAAGGATCACCCGATCAAGGACACGACCGA