Description :
From Genome Similarity Track
Location :
Scaffold_30:370628- 371670
Transcript NameFunction/comments
Phyra_71601oxidoreductase

Sequence
1042 bases(100 bases per row)
TCAACTTACACAGAAATGCGGTTCACGCGTTCGGTCTTCTTGGCGTCTTCCAAGATGCGGATCTGCTCGACCACGCCTTCCGGGTCCACCAGCAGCTTCT
CCTCACCGCGGATAGCCGCTGCGATGTTCTTGTAGTAGACCTGGTACGAGCCGAGCTTGGTGGGGATGACACGGGTCTCGCCCGTCACGGCGTCCGTGAA
CTTGCCGAACGAGCTCTCGGGCTCCTGGCCCCAACCTTCGTCGCCCGGGCGCTTGCCAGCACGCAGGGCGTCCTCCTGGCCATCCTCGCCGTACTTGACG
AACGTTCCCTTGGAGCCCACAACCGTGTACTTGGGGCCGAGGTCCTTGACGAGCATCCCGGCGCTCAGAATCACCTCTCGCTCGGGGAACTGGTTGTACT
TGAACTCGAGGCGGAAGAAGTCGTCGTTCTCGGCACCTTCACGCTGGATCTGCACGTCAGCGTCGACCGCATCGGGCTTGCCGAAGAGCTGCAGCGCCTG
GTCCGTCACGTGCGCGCCCAGGTCGTAGAGCACGCCGCCGCAGAGACCGGCCTTCTCCTTCCAGTAGCCCTTCATGGTGGGGCGGTAGCGGTCGTAGTGG
GCCTCGAACCTCTGCACTTGTCCGAGCGTGCCGTCCTCCATCAGGCCGCGCACCGTGAGGAAGTCGCTGTCGAAGCGGCGGTTCTGGAACACGGAGAAGA
GCACGCCGTTGGCCTGGGCGACGGCGCAGAGCTCCTGGGCCTGCTGCGCCGTGACGCACAGCGGCTTGTCCACGACCACGTGGCGCTTGGCCTGCATGGC
TGCCTTGGCCTGCTCGAAGTGCACCGTCGTGGGCGTCGAGATGACCACGAGCTGCACGTCGGTGGCCAGCAGCTCGTCCATGGAACGCACGATCGTAGGC
GCGGGCGACAGCGCTTGGCTCTTGCTGCTCGAGCGCTCCAGCACGTGTGTGAGCTCGAACTGGCCGGAGCTCGTGATCAGCGGCGCGTGGAAGACGCTGG
AGCCCGTGCCGAAGCCCACGAGGCCCACAAGGATCTTAGCGG