Description :
From Genome Similarity Track
Location :
scaffold_772:3704- 5829
Transcript NameFunction/comments
Pl_102483pol protein
Pl_102484hypothetical protein PHYSODRAFT_505334
Pl_102485NA

Sequence
2125 bases(100 bases per row)
AAGGTTGATACGTTTTGGCAAACGCTGTTCCGCCTATTGGGAACCCGGTTGCTTACTTCAATCGTCGGAGGCACGCTACGCAGTGTCTGTGATGAGGCAC
CACAGTCGTGGACCAAGCGCTTACCCATGGTTGAGTTCGCACTCAACAACGCGGTGCACGCATCAACGGGGTTTACCCAGTTCTACCTGAATGGGCTTCG
CCACCCAAGTGTGCCGCTCACTTTGCGTGGGCTCACCGTGGATTCAATCTTAAGTGGGGGGAGGCTCGGAAGGCCTTTCCTCCCAAGTCTCTGAGGTGAG
ACCAGTTTCGTTGCGGAAACGGTTGTCAACCTTTGTTGACAACAAGCTGACTCTCATCAGCAGGGTTAGAAACGCTATGGCGGACGCCTGTTGCAAAAAA
AGGAGTACTCTGACCGACATGGAAGAGGAAACTCAAACGTGTTTAAGGTGAGTGATCTAGTCTTACTCGACATTAGAAACCTACCTATAAACTTGGTTAG
CTCCGTGGGGAGCAACAAACTGAAGCACCGCTTCATCGGACCCCTCGCGGTCCTGATAAGGCTCGGCGCTGCCTACACAATTGACTTACCGAAGTTGATG
ACGACCCACCCGACGTTTTATGTTGGTCGCTTGAAGCGGTATCATGACCCGCAGGGTCAGAGTGCACCGTCCGCAGTGGTGGTCGATCGCATGCCGATGA
GTCAACCTTTCAACCCGTGGTTGACTGTGAAGATCCACGTGCTCAGTCGTCGGTACCGGTCGAGGATATAGACGACTGACATAAGCAGACACGAAAGGCT
GCTGGGCGTATGATGGATGTCGATACGCATGCACCTCGTACGTCGCGTATCAACCATACGAATGGGAGTACGCAAAAGGTTGCGACTCCCGGAAAGTGGA
GGACGAGCGCTCCAGGCCCTCAAGGTCAGACTTTGTCGCACGGCGACCAACACGCTGATGGATCCCTCGGAGAACGCGCTCCTGTGACTCCAAGTACTCA
CACAGGCGAGGGACAAGTCCTGGTTGGCCAGACTGCAAAACAGCGTCACTACCAGGACCTACACCAGTGGCACACTCCACCGCGTACAAACGGTCACGGA
GTTGGCGGACATCCTTTGCCATCAGAGCCAGTGCCTGGTCTCGAGGATCAACCGAATCCTCCTGAGCCACCTCCCTCAAAGGTGGCTTGTACGAGTAGTC
GAGAGCGGCCACCGCCAGCCCTCCTCGACTGGAATGGTGAACTCCACTATAATGTCGAGCGTGTTCTCCAGGAGTAGCGCTTCCACGGGAAGCGCCACCT
GAAAGTGAAGTGGCGGGGCTACCCGACTTCACAGAGCTCATGGGAGCCCATCGAGCAGCTCCAAGTAGACTGTCCAAAGGCTGTCACGATCTCGGAATAG
AAGCGATGCCTTCGCAAGTAGTGCGCTGCTTCTTAGCAGCTGTATGGAGTGCGGCGGACGCATAAGTTTGTACTCTCTTTGGGTGGAGGACTGCGTGTCT
CTCTTTAACCCTGTCATCTCAGTGATGAGCTGTCGCCTCGCGACGAGGTGGGCGAACTGGACTCAAAGGTCCCGCTGGAGCAAGATGAAATCCAGCTCAG
CTTCAACCTGGAGCTCCTGGGCCGGACAACCCTTGTCGGCGACCCACCTCCAGAACAAGGCTTCGGCCTGTGCAGCCGTGGAGGTGTTCTCCGGCTCGCT
CATGGGAAACCCCACACCAGGTGAAGGCAACCTTTGGTCTCAGGCTTCTTACGAAGACTAGTGAATTCCCGCAGTAGAATTCTGTGCGTTACAAGAAGCA
CGCACCTGGCGGTCTCTATGTTCTCAATGAACAGAGGCACGTCTTTTACAAGTTGGCGCTCGTACTCGCCCTTGGATGTGTGACCTCCAATCAGTGGACG
GGGGTCAGTGAGTTGCTCGAGGAACAGCTGAGACCTGTGTCCTCATCGGGTGGATAACACCCTGGAGCATGAGCCATAACCCGGTGCTCTGCGTGAATAG
ACTCACAAGGAAGGGGGTGTCCAGCCACATGAGCAGCAAGCGATGCTTCTTGCTGCTCGTCGAGGGTGTTCGCAATCTCTGTTGGTCCTTCGACTGCTCC
TTCCTTTCCGGAACTGGAGTCGAGG