Description :
From Genome Similarity Track
Location :
Scaffold_299:3703- 6613
Transcript NameFunction/comments
Phypl_g6657hypothetical protein PHYSODRAFT_308768
Phypl_g6658hypothetical protein PHYSODRAFT_475208

Sequence
2910 bases(100 bases per row)
CGGCGAACTTCAAGTTCCAGTCACAAATCACAACTCCAAATATTTGTGATTTAGTCCTCCTCCCAATTGTACAATTTTCAACGCGGCGGAGGGAAACAGA
CCAAAAAGCGCGGCAATCACGTCCCAGCCGCGAtgccgcgccgcgccgccgagaaGCCCggggagaagaagcgcgggCGTCCTCagaaggccgacgccgc
gcccaagaagaagaagccgcggcggcgcaaGAACTCGTGGGactacgaggacgagaacgacggcgacgtggcgttcgaggacgccgggggccacgacgac
gacagcgagtcCGAGGACCaggccaagcccaagaagaagcgcggcCGGCCCAGTACAGCCCTAGCCCCGTCGGCGGTGACAGAGGCAAAGGCGCCGCCCG
TGCaccggaagaagaaggcggcgagcgTGCCCCgggacgaggaggaggacgaggaccgCCTCTCATTGGCGGAGAGGCACcgcagcaggaggcagcagta
cgagcgcgacagcgagcagctgctgcaggaggtgcgcggcctggcgctgcaggagaagaagacgcaggagaagctcgtcgagaagctcaagcggGACGTC
ACGACGCTGTCCaagcaggcggaggaggagcgcaagaagcgcaagaaggacgtggacCGACTCGTGGCCGACAAGATGCGCGAGTACGACGCCAAGCAGA
GGGGCCgagacgacgcagacgcggagaagacggcgctgcgggAACGcatcaaggagctcgaggcgcagTTTGCGTCCTTCAAGAGGAGCACGGGCCCCGA
GGATGTGGTGACGGtgaacgcggcggcggcgtcggccatgcAGAACAGCGAAGCCACCCTGCAGCTCAACCAGGCGAACAAAGTACGTGAAGGGGCTGGG
CTCACTGTGGTGTATTGAGTGCTCTAGTGTCGATGCTGTGGGTGACCTGACGCCTTGCTTGTGTGTTGGATTTCGGCAGCTACTGGAGTTGTACCGCCTG
GTGACCAGCACGGAGATTCGGCTAATCCAAGCGGgggatgacgacgacgacgcggacgactGCACCGAGGTCGTGTGCACGGCAAGAGACTCGGCCACGG
GCAACCAgttcgagttcgagctgGCTGTCCCTGCCGTCGCATCAAGCGAAATCGAGTATCTCCCGAGCGAGACGCCACCGACAGGCATCAAAGTGCCGTC
CTATTTACGAGTACGTTAGGAGTGGGCTAGATGCTTGGCTGGGTTTGCTGCGCAGAACTGACCCGCGCTATGGTGTGTATCTTGCTTGTGCTTTCCCAGG
AGGAGCTGAGCTTCAGTAGGTCCGAGATGACCAAGTTCATTCGATCAGTTCTCGACGTAGTCATTAGAAAGAAGAAAGTATAGGCGCCCTCGAAGCCAAG
CTGCTGACTGGTGAGTGGAGGTAGGAAGGATGATCCTAGTGTCCTAGTCGCCAGCTTCAAACCCTGTTCTGCTTCCCATGTTGAGGTCCTGTGCCGTATT
TTAAGCGTTGCAGTGGATGGGTGCGTGGCCGTTTGTTGTTTTTCAACTCGTCTATTAGTATGCGGTGTCCACTTCTACTCTTCCATAGGGACAGCCTCGG
ACTTGGGTTCTTCCTTGACGGACACCGACACCGGTTCTTCCTTCACGGCATCTTCCTTCACAGCATCCGgcatgagctcgtccttgacgGTTTCCAGCTT
TGGCTCTTCCTTGACGGGCTTATCAGCCTTAACATCAGTTGGGGTTGCTTCCGTCGGCTTCTCGATTGACGCATTAGCCTTCGAGATGGCGCGGAACTGC
TTGTACTCGTCCTTGGAAAGAAGCGACTCCTGAatctccgccacctccaccttcttgggCTGAATGATGACGAGGTATCCGTCCGATTGGTGCTGCaagg
caagaagaagaccgcATTAGCCAAGAATATCCTATCCAGACACTCCAGCAAAAGCAAACCTACCttccgcttcagcagctccggctccTTCTGCAGACGC
TCATTGACCTCGATCAGCGAGCCGCGAATGCAGCTGTAGAGCGTGAACTCGCGGCCGCTTTTGCACTTGAGGACGCACAGCACCGTGCTCTGCAGCATGA
AGCGGCCccctttcttcttcttgcccatCACGCGGCTCTCCAGCACATTCGGCGTGAACTCGACGctcaccagctcctcctgcatcACCGGGTGGGACTC
GGCCACGCCCACCACACACAGTCGGTTGGAGTGCATGTGCACGTACTGGTCCTCCATCGAGTTGCCCATCGTGTCGCACGAGAACATCTCCGTGTAGTAG
CGCTCAATCTGCCAGCACGCACCCACAGCATCCGTCAGTCCCCCAATGCACCACAACCtctcaccagcagctccacctgcACCCCACCATTGTTCCTCGG
CGCTTGGAGGTCACGGCACCTTCGTCCGCCGTCTGGAATTGCTCCTCGGCGCGATGAATCGCCTGCTCCCGGATGAGTTTCCGCTGAGCCGCCACCGAGT
GCGTGTCGCTGTCATTCACCTCCGCGCTGCAGACACACAAAGAACTATATCGTCACCACGGAGCAGAGAGAGATTTTGATCGTGCACAATTAACGGTGGC
AGACGCACCGGCCGTGGGCGAATTTGCAGTTGGGGAACGGGCAGCCGCCGGGCTTGTCGAAGTGTTTGCACAGAGCGCTCTTGCGCAGCCGCTCGCGCCT
CTCCACGCGCCGTTTCTTGGCTACTGGAGCGGGAGACGCaggcgaagacgctggcgccTTCGGTGCAtcggcgctcgcggccgGGGGCGCGGGCGGAGCC
GCTGCATCGGCAGGTTGGGtcgtcgccatgctgcttGATTGAGTTTTTTTTTGGTCTCTTTTTGTGTGGACCAATCATTGGGCGGAATCAGATGGCGTTG
CAGTGGTAAA