Description :
From Genome Similarity Track
Location :
Scaffold_276:3703- 5926
Sequence
2223 bases(100 bases per row)
CCTCCGCGTTCTCGTGCGACTGCATCGCCTCGAACCGGTTGCGTCCCGTGCGCTGGCGCAGGAAGTCGTACAGCAACCCGCCGCAATTCAGATCGAGCTC
GTCGACCCACGTCGTGTCCGGGTAGCCTTTCCATTTGACTTCGAACTCGCGTCGCGTGCGCCCATACCGGGTAGTCCGCCCCTCGCGCACATTCACGATC
TTCTCGACCTCGAAGACGTCGTCCTCCAGCTCGCGCGTGGCTTCCCAGCTATCCTCGGGCAAGAGCTCCTCGTCGAAGTCGAAGCGCTCCTCGGCCGGCA
CCGTCAGCTGCGTCGCGGGTCGCGACGGGAATTCCCGGACGGGCTTCAGCTTGGAGATGTGGACGACGGGGTACAGCTGATAGGGCGTACCCGTCGTCTC
GAGGCGCACTGCGAACGCGCTGACCACCTCGGTGACGCGGAAGGGTCCGTGCCACATGTGCGCGAGTTTGCGCGCATACCCCGGCTTCACCCGATCCAGG
TACAGCCAAACTTGCGAGCCCGTCGCGATCTCATGTCGCGTCGCGTTTTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTCGGACTAACTCCAACG
CTTGTGCCCTTGCCACCTTGTAGTGTCGCTGAATACGGAGCCTCCACCGCCGCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGCCAGCGTCGACCG
AGGATCCCAGTCGTGCACTAAGAAGAACGGGGTTTCATTCCTCGTCCGGTCGTACGACGTGTTTAGTGCGAAGGTAAGACGCTCGGCGTATTCGTCCCAG
TCGCGTTGGTCGACGTCTGCGATGTACATCTTGATCGCTCTTGTAACCGTCTGCACCATCCGTTCTGCAGCACCGTTGGCTTGGGGACGATAAGCAAGCG
TCGCTCGCTGTCTCTGACCCATGATTTTGCTGAACGCTTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCGGATAGCCGGGCTCGTGCCGAA
GCGCCTGAACACCGCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGACGCATTCGCTTTGACCACGACGAACCCCGTGAAGAGGTCGACCCAG
ACTAACAGCTCTGTGTTGCCTTTGTAGGATGCCGGCAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGTACGTCGTGACGATGTTGCCCGGCG
ACTCGCCCTGGATGGTCGGCCGACCCTTTCCCGTCTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCTGAAAATCCCTGGTCAATGGAAGTG
GCGCCTCACGCGTTGGTACGTGCGGCCAATACCCTGGTGTCCGCCTCCAGGCTCGCGTGATAGTGGTGGAGTACATCTTCCCGAAGAGTCTCCGGGATCA
GCTTCATCATCACATCGCGATCCTCGGCGGAATCGTCGCTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCCTCTTCGTACCGAGGCGCAAGCTTTTG
GCAGTTCTTCACCTCGCGCCGAGATAGGTCCCCGACGTCGCCGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTTCGTCCTGGGCGACGCGGATG
CGGTCCAGGCGCATTCGTTGCACCACCAGCTCCTCCAGGACTTCTGGAGGTCGGACCCTACGTGTTGTCGTGCGTGCGGCAGCCGAGCGCGTCGTCACAG
CGAGGACTTGTGCTGTCCCGCGTCCCGCGTCCATGGCCTTCCCGGCGGGGTCATCTGCGCCGCGATTTTCCGCGTCGAGGTTTTCCGCGTCAAGATTATC
CGCGTCGGGACTGGCTGGAGACGCCATCCCGGGACTCGATGTCCGCGGTCGGATGACTTCTTCCAAGCGATTCAGCGTCTTCAGATCTTGAATCTCTTCG
GGGCTGTGCGCGTTGCGGCCTCCTTGACGCTGCAGAGCTTGTCCAGCCAGCATGTCGGCACTCGCGTTCCAGTCTCGTCGTACGTGGAAGAGTTCGTGGC
GCGGCCATGCCTGGAGTGCGTTTCGCGTCTTTTGTCGCAGCAGCTTCAGCCCCGGGGACTTGCAGTCCATCTCGTCCGGCATCTGCCTGATGACAAGGTT
AGAGTCTCCGCATACGACGAGTCGGGTGACGTCGTCGAGTTCCTCTAGAAGAGAACATCCGAGCAGCCGCCCGCGGTATTCCGCCTCGTTGACCGTGAGG
TCCGTCGCATATCCCGACGCGGC