Description :
From Genome Similarity Track
Location :
Scaffold_325:3701- 9056
Sequence
5355 bases(100 bases per row)
GAAACAACTCCCGTCTGGATCGTACTCGCGCTTTCTTGATCGCCACACGGTGCTTGTAATACGCACTGTGCAGAGCATGGGAAGAGTGCAAAACGCGGTG
GGGAAGTCTTCGGTCGACGTGCATTTCAACATGATGGCCAAGCTGCTCATTGAGCATAAGATCGACTCGTCGCGGGTCTTCAACATGGACGAAACTTCGT
TTACGCCGAAGCCCACAACTCGTACCGTCATTTCCATCAAAGGCATAGGAAATGTGTGGACGCAGAAGATCAAGCCCAACTTCCACATGTCCGTGGTGGC
GGCGGTAGTGCGTCTGGTTTCGCTATCCCTCCCCTCATCATCCTCCCTGGCGTTCGTCCGCTCAAGACAGAGCTTGTAGCGCTATCAATTGACGGCACTC
GCGTCACAGGTGTGCCAAAGAAATTCAGCAATGCAAAGATCTTCAAGGACTGGCTGGCGATCTTCTCTACCGTGCTGGAAGCCAAGGTATTCAAAAGCCA
GTTATTTTGACGTTGGATAACTCTTTCACGCACGTGGATATGGGCAAGTTTGGGAAAGCTTTTTATCATTATATTTTTCTCATAATCACTTTTGTTGGTT
ATTGTTTGATAGAGTCGGTACACTTCTGCTGTGAACATGGCATCCTGATGGTCGCCTTGCCAGCAAACGTGACGCACATCTTTCAGTCGCTTGACGTGGC
CGTGTTTAAGCCTTTCAAAACAATCATCCGCGAGCCTCTACAGCTTCAAATGTTTGAAATGGCGGACCCAGCGCTGGATAATGTGGTATAGAAATTTTTG
GAAGTGGTATTCTCTGCTATTGCCAGCTTATAGAGGTCGGAACTCGACAGGACAGTGGGCTGGACCCGACATGAGGGGCACGTCCAGCATGTTATGACGA
GATTAGTCTCAACGTTTTAAGGTTAAAACGAGTTAAGATTCGTTGAGTGAGGCTCTTCGAGTGAAGACTCGTCGATTAAAGTCTCGTCGAGTGAAGTCTC
ATCGAGTGAAGACTCGTGGATTGAATACTAGTTGATTGAAGGCTCGTTGAGTGAAAACTCGTCAAGTGAAGTCTCATCAAGTGAAGTCTAGTCAAGTGAA
GTCTATTCAAGTGAAGTTTCGTCGAGTGAGTCTCGGCGAGTGAAGAAACGTCAAGTGGAGACTCGTCGAATTCAAGCTCGTCGAGATCAAGATCGTTGAG
TCTTACTCGACGAGCTTGAACTCAGCAAACCACCTGCCCCGCCTCGATGTCATAAACTCGATACGCCTTAGACACTTCTTCGTAACCCAAAAATATGCCA
GCGCGAGCCTTTGGATCCCACTTGGGTCGATTCGCTTGGCGGCAGCAGATATCAGCTACTGATCGTGGACGAAGCCAGTGAATGTATGAAGGGCTTCTGT
TTACGAGTGAAGTCCGAGAGTGAAGACTACATCCGGAAGTACATCACTATGGTACAGACGCAGTTCTGTCAGAAAGTCAAGTTTGTGCGACACGACGGAG
CCCGCGAGTTTGCAACCAACTCGCTTCAAGTGTTCTACGAAGACGAAGGCATTGAACAGCAGACTACGGTGCAATACGCACATCAAACCAACGGCACAGC
AGAGCGCGCCATTAGGACTATCGTCACAATCGGCCGCAGCATGCTCCATCATGCCAAGCTGGACAAGTGTTTCTGGGCTGAAGCAGTGATGACGGCCATT
TACGTCAAGAATCGACTGCCGTCACCTAAGGTCGTACACAAGACCCCGTTTGAGATCGTCTACAACTTGAAGCCAAGCGTCAAGCACATGCGAGCATTTG
GGTGTCAGAGTTACATACTGACGCCAAAGGAGAATCGACTCAAGTGGGATCCAAAGGCTCGCGCTGGCATATTTTTTGGTTACGAAGAAGTGTCTAAGGC
GTATCGAGTTTATGACATCGAGGCGGGGCAGGTGGTCGTCAGTCGCGATGTCAACTTCGACGAGTCCACCTTTGGACTTCCGTCGCCAATCACCGTTGAA
GATGCCGATGACCTGGACTTTGAATTACTTGACCTCAATGATGAAGAGCCGCGTCAGATGGAGTACAAGCAAACGGGCAAGTGCAAGAGCCACATAAATG
ATGAAGATTCAGCTGCTCTACGACCGCGTGCAGTGCGTCAACCGCCTGGACTAGAAAAGTCAAGCGCGCCGAACAGCAACTCGTCACGCCAAGAAGAAGA
CGAAGAAACGAAGGATTCTGATGAATCAACTCCGCCTGTGTTTTGGCGTGCGAGTGCGAATGCCGTTGAAACAGTAGCGGATTTATCGGAGCCGTCAACA
TTTGAGGCAGCAGTGAGCGGCCCTGACCAAGTGCACTGGCGAAAAGCCATTCATGCGGAGCTCGAGTCAATGCGACTTCGCGGTGTGTTTCGTGCAGCCA
AGCTGCCCAACGGACAACGCGCCATTGGTACGAAGTGGGTCTTCAAGATCAAGCGCAAAGCGGATGGATCTATCGAAAAGTACAAGGCGCGCCTCGTTGC
CAAAGGGTTCAAACAGAAGTATGGCATCGACTACACGCAAACGTTCTCGCCCGTGGTCAAGTATGTGACGCTACGCATGATCATTGCAATTGCCAAGCAC
TTTGGATGGACCCTCGACCAGCTTGATGTGGTGACGGCTTTCCTGTATGGTGTCATGAAGGAACAAGTGTTCTGTGTGATTCCTGAAGGTGTTGAACTTG
ATAGCGCGTTCTACGGCCTAGAATTGGTGAAGGCAATTTACGGCCTCAAGCAAGCGTCGCGCGTGTGGAACGAGACGTTCGACGAGTTTGTGTGCTCCAT
TGGATTTCAAGTATCGGGCTTCGACCTATGTCTCTACATCAAGATCGTGGAAGACGAATGTGTACTGGTGGTGGTGTATGTCGATGATGTGCTGGTAACA
GGAAGCTCGCTCGAGCTGATTGCACGCACCAAGAACGACCTGAAGACACGCTTCGAGATGACCGACAGTGGCAAGTGTGCATTCGTTCTTGAAATTGATC
TTATTGATGGCGCAGACGGAAGCGTGACGATGTGTCATCGCAGATATGTGGATGACATCCTCAAGCGTTTCGTCATGGAGGATTGCAAGGCTGTGGCAAT
TCCAGTGGACATGAGCTCTCGACTTGTTTCGAGTGACGCAGCTACCAAGGTGGATGCCCCGTTTCGTGAAGCAGTTGGTGCTTTGATGCATCTGACTACT
GCGACGCGCCCAAACATCGCGTATGCTGTGGGCTATGTGTCGAGATTCATGGAGAACCCACAAGAAGATCACTGGATTGCGGTCAAGCGTATTTTGCGCT
ATCTACAAGGCACCAAAACGCATGGAATCAACTACAAGCCGAGTGGCAAGATCGACTTTCGTGGATATTCGGATGCAGACTGGGCCGGTGACCTCGCCGA
CCGCAAGTCGAGTTCGAGCTACGTGTTAATGCTATTGGGTGCACCAGTGAGTTGGGGAAGCAAGAAACAGCCAAGTGTTTCGTTGTCGACGAGTGAAGCA
GAGTACATTGCACTCAGCCTGGCGATCCAAGAGGGCAAGTGGATCGATCGCTTGCTGTGTGAGATCATGACGGCTGCCAACGAGGACGGACCCGAGCTCG
TGATCCGTGAAGACAACCAGTCGTGCATCAAGATGACGAAGAACCCTGTCAACCACGGCCGCGCCAAGCATGTTGATATCAAGTATCATCACATCCGTGA
TGAGGTCAAGCGCGGCGAAGTGAAGCTCGAGTACTGCGAGACTACGTTGATGTTAGCGGACATCATGACGAAGGGACTTCACAGACCACGCCACAAGGAA
CTGACGACGGCGCTAGGCATTCATGCGTGTTCGTATTGAGGGGGCGTGTTGACGATCATCGTTTTTCTACCAGTATTGGTAACCTTGACCGGTTCAATCC
GAACCGCCTGCTCAGATTATTATTTACGACGTAGTTCTTACGGTAATTACCATAGTTGATTAGACGCGTAGGATGATGAGACGCTTCACATGATTTATAT
GTACACCACATATAAATCATGTAGTAAGTAGTAAGCCCCGATAATCAATCACGTTCGAATCTTCCAACTTGTGAGCTGAAATCTTGATGGTCCAAGTCAC
TAGGTCATTGTATAGGTGAAATAGGGGAATGGACGGGAGCCAGACGATAGGCTCCCTCCCAGTAAAAAGAGATAACTAAATACAGAGCAGAATCTTCCGA
GTCCTAGTAAAGCGTATACTCTTCCGATGAGTCCCTGCGTGGGCTGGATTATGCCTGCCGTCGAACCTCGAGAAACATAGCATGTAGAGGTTTCGACTGC
AAGCGTCAAGAGTTCAAGTTGGCCCGGGGTGAGCAATACTCGCTTTCAGCGAAAGAAAGAGCATCGTCAACGACGAGCCGGTCAATCCAATAGATGGTAC
CGCTAAAACCTCGTCTACTACAAGCCGGTCAACCCAATAGATGGTACCGTTTGAGTCTCGTCGAGGGGCGAGCCAGTGACTTAGTAGACGGCACTGCATT
CAGACTCGTCGAGCGACGAGCCGGTGGGTTTTTAACCAAGGACACCATAAATCTTCTAGTCGAGCGTACATTGCACTCGGTGACCTGTAAAAGCGTGAAA
ACGCCGACATCCATCCATTGGTGTGAGTCACAGGAGTGTGAGTTTTAGAAGATGCTGAGCTCAGGAAGTCTTCAGGAGGAATGGGTTGCAAGGAATCCGT
TAACCGAAAGCTACAATTGAACCCGAAGGGGCGAACCGCGAAGGGATTTTATCCTCACGTACTAGCCTAATTCGCCGAACCAACTCGGCGATTGTTGTGT
TTATGCGTTTAAGGCTGTATTGCTACAGATTTACGAACTACTATACCACAATAAACAGATAGCCATCGAGATTGTGTGTTATGCATACCGTATCGCCATC
ATTGGTCATCCTCGCAATGCAATCAAGGGATTCGGGGGTACTGGACTCTACCCTCTCTTTCTGGTTCAATTACACAAGCTTCTCGGTGAGTATCAAGCTG
CGGGACTGAAAGGAGACTATGGCAATACATCCTTGTTCACCGCCCGAATGTGGTCACCACAGTCCAGAATATGATCTCCACGCTCCCTCCAGAGCCTGTA
CGGAAGCAGAAGAAGCGTAGAACAACGATAGACATCGCAGGCAGGTTGGGTTACCAAATAAATGCTTGTAGAAGCATCCGGGCAGTAGTCGTGCACGAAA
CCGGTACCGAGTAAAATGGGCTTATAATTGACTGATTTTTATAACTCGTAAAACTTTGTACAATAATGTTATCAATGTGCAACTATATGGATTAAAACCG
CATCTAAAATGGCTGTAATATGATCTTGTCAGATATATCCGATTCGTATCATTTA