Description :
From Genome Similarity Track
Location :
Scaffold_2005:370- 4418
Transcript NameFunction/comments
Phyag_g11888hypothetical protein PHYSODRAFT_564322

Sequence
4048 bases(100 bases per row)
ACCAGAAACTGGGCGATATTGACAAATTGAAGGCTATTTTGCAGCTTCCCAATATGCCACTGCCTTATGACGCGTTGTTCGAGGTAAAATGCGGCAAAAT
cgaccccccccccccagaGCCTCCTACGACGTCTAGAAGATGATTAACGGGGTTTTGTTGTTTGTATTGGTATCTTTGGCTTATAGGTGCTacatctgct
gctgtttttcTATACTGGAAGTGGAGATGATGCTGGGAGATTGCTGCAATTGACTTCACTGTTCGGGGATTCGTTGGCTGCTGTTTCGGATGGGATTAAA
GGCAGTGAAGAGAAGCAGAGAGACTGGCAGCTGCGGCGATTCGTCGACTTGTGTCTGCAGTGCAGGTCGGCATCGTCTTCAACAGTGGAGGTATCGGTCG
GGTTTAAAACTGTGAGGGTGTTGGCTGAGACGCTGCCAGAGATTCAGCAATATTTGCTTTCAGGTCAATTGGTTGTGTGCCACCCTACGCAGCAAACAGG
GAAGATGCTATACAGCGAAATGCCCAGAACTTCCGTGACGCAGATCGTCCGCCAAGGGTTAATATCGGCAAGAGGGCAGATTCCCATTTCGTCTAGCGCA
ATGGAATCGCTGTATTGCAATTCTTTGATGGACTTTGCAGTGCATCTTCTCACGACAACAAGTGGAATTCTTGAGGCGTTTGTGATGGAGGTAAGTTGTG
GCATTAAGCTGTGGTAGCTTTAACTGTCTGACATTGTGCCGATGCTGTACGTTTCACGCGTTGTCAGGTCTTTTCAGTGCCGGTTCTAAATCAACTGGTT
GCAAGCGatcatctgcttcagctcaCTAACTTGTCGCTGTGGACTAGACTGTCTAGTGCCGGCCTGCACTTGTCAGTGTTCGATTTTCCACCTTCACCTG
TTACTGGAATCGCATCTGAAGCCTGGTTTCTTGGAAATATCCTATGGATTTCGGATCGGTAAGCTTTGCAATGACCACCACATTGTGTTGTCAGATAGCA
AGAAGATCTGACAAATTATTGGTGTGCAGTGTGGAGGGTAAAACCGACAGTGTTGTGCTGAACGAGGTCCAGCTCCTCTCGAAGCTACTTCAATCTGTGC
CGCCTGCAACGTATGCTGCATCGGGAGTGGCTGTTTCGTGGACGAAAGTATCCGAGTCTCACTCCGTGCCCGTGGTGTTTCCAGAAACTTTGAACGAACA
GCTACAAATTTTGGTAAATGATCAGTACCTGCGCACAATGTGTAATCACCTCCTTTCGTTTTCTCCGAGCGCTCTTCGCCACCCGTTGGCAATCCAACGA
CCAACGCCAATGTATCCCGAAGCACCAACAACTGCGGTGAGGGTGGTTTCGTGTGCCAACTTCTGTCCTAAACTAACGAAGGCGTCTTTTTTGTAACTTC
TTTCTGCTTAGGAACAATTTGGTTTTGGTGACATTGCATCAGCATCTTCGCTTTCAACGTCACTGTCAGTAACGTGGCAAAAGATGAAATCAATTGGAAA
GGCGACCTGGGCCCGAAATTTGTTCGAAAAAGCTGGGTTGCGTCGAAAACGGGAGGGTGACGAAGAAAATATCagcgttggtgctgcttctcagCTACAA
AATACTTCAAAACAAGCGCGTGAGATTGCTGCAAACGGGGTTAATGATTTCGACAAACCATCCTCCTCTACAGGTCAACGTGCAGCCAccttgaagttgt
cgagaagCTCCGATCCTTTCGTTTTGGAGAATATTAAGGCATTATCGTGCCTGTGTGGGACATTCCTCTTTCGCTGGGGAAGTGATGGTGGGAAGCGTCA
ATCCTATGCAATGCGTCTGCTCAACACGCTGGCCTTCTATCACGTTGAGGTTGTCGAAAAAGAAGGGGACACGACTCAAAATGTGTCTTTGGTTCATGTG
CTGTGGTGTGTTTTGCAAGATACAAAGAATTTCGAAGATTTTGCCAAGGTAAAAGTGCTGGTGATTTGAGTGACGAATGTGTGCAACGAACTAACTACGT
ATTCGTGACAGAATGTGGATTTAATTCATGCTCGGAGTTCAGATCCTTATGTGTGCATGCTGGTGTTGTTTTGTATGTCATACGAGCATCTTTTGATAGT
gatggacgatgaagaggtgAGCTTTGCCGTTGCAGTCGTGGATCATGCTTGTAGGATGTTTACTAACTTTGTGACCCTGTAGATGTATGATCAAGAGTAC
CCACTCCCTCTTTTCCAGATCGAGCGGGTTATCCTGAGCTTGAAACATGCACTTCATGAATCGTATTGGAACTACGCCAATcttgctccttcttctgaAT
CAGTCGCGTTTGGCatgttcgtcgtcgaaatGGCGACTCGATTGATGCGAGTCCTATACAATCGATGTTCTCGTCAGCCATTTTGCAACGTTACGAGTTG
GTACGTTGACGCTTGACGATAGGAGATTTTCAATGTTATACAAACTGATGACTAATACCGGGATGGATCTACACGAACGTATGGCATCACAGGATCATCA
CCGAACTTGACAGCAACCAGCTGATTGAAGAAGTTTTGCTGGGCACACCTCGAGCCAACAAGCTAATCCAGTCGATGCCATATCTTGTTCCGTTCCCTGA
CAGAGTGAAATTGTTCCAGCGACTTGTCAAGGCTGACAAGGACATTCATCAAAACGAAAGCTGCTCGGTTTACCGCATCCGTATTCGTCGCGGTGCAATT
CTCGAGGATGGCCTAAGGAAGCTCAACTCAATTCGAACGAGCTTGAAGAAGCGCATTAACGTCGTGTTTGTGAATTCTGCTGGTCGCGAGGAAGTGGGTA
TCGACGCTGGTGGGCTCTTCAAAGAGTTTTGGCTGGATCTATCGACGCTTGCGTTTGATCTGCAGTACGGACTGTTCCTCACGACCCACGATCAACTGTT
GTTTCCCAATCCCAATTCGGCATCGGGCCATTTCTCGCGTGAAAGTGACCACCTGACGATGTTCCAGTTCGTCGGTCGGATCCTGGGAAAGGCTTTGTAT
GAAGGCATCGTGGTCCAGCCGAAATTTGCCCACTTTTTCCTTTCCAAGCTTCTGCATTCGTTCAACCAACTGAATGAGCTTCCATCACTCGACCCCGAGA
TTTACAAGGTATGTTTCCAGTCAAGGCGCAGGTCTGCAAAAGACTTTTATAGATAGTAACTTTACTCTCCGCCCTGCAGAATCTAATGTTCCTCAAGTCT
tacgacggcgacgtggaggacCTAGGACTGACTCACACTGTAGTCCAAGATGTCTTCGGCGAGCAGAAGGAAATCGAGATCATCccaggaggaggtgacg
TGCCCGTTACGAACCGAAACAAGACGCGGTACATCCACCTTGTTGCGAACTACTACCTCAACACCCAGATCCGCGAACAATGTTCAGCGTTCCGCACAGG
GCTCTCCGATCTCATCGACCCGCGCTGGCTTCAAATGTTTAACGAACCCGAGTTGCAAGTGCTGATTTCGGGTAAAAGTGGCAAGATCGACGTCGATGAC
CTCAAGGCCAATTCACGATACGCAGGCGGCTACTACGCACTGGATAAACGCGTCGCGTGGTTTTGGCAAGCTCTGGCAAGTTTCACACCATCAGAACAGG
CCGCATTCTTGCGCTTCACCACGAGCTGCCAACGCGCTCCGTCGTTGGGATTCGCGTCACTCACGCCGCAGTTTTGCGTGCAGAAGATCCCAATCCGAAG
TGATGACGAGCTACTGCCTAGCTCTTCAACATGCTTCAACACGCTCAAATTGCCAACGTACTCCTCGTACAAGGTGCTTCGTGCGAAGCTGCTCACGTCC
ATCTCATCCGGTGCCGGCTTTGAAATGACGTAGCCGTCCAGCCAAAACTTCTGGACGTGTTTTTCTTTAGAGAGCACTTCAAAGTCTGGGAATCAATCAC
AATATGAGTTCCATCTCCAATACCAGAGTAAGCGAATGCGCGCACACAAAAATTCACTAAGTCGTTAAGGCAAAAACTGGTCTTGGCACTATCAACGATA
GTGGATGCGTTACCATTCGTGTTTCCAACTTCTTCTGACTGTGTATAC