Description :
From Genome Similarity Track
Location :
Scaffold_2509:370- 2876
Transcript NameFunction/comments
Phyag_g12540hypothetical protein
Phyag_g12541hypothetical protein PHYSODRAFT_262200

Sequence
2506 bases(100 bases per row)
AGAGCACAACCGAGCGGGAACATCCCAAACAACtatggagcagcaggacgccggcggaggtggcgggAGCGGACACCCGACGTTGAACCCGACGCCGCGG
CTTATCGCGGCGCCTCACACGATGGACACCGAACTCAAGCCGTGGGAGCTGTACATCCTTGACGGCGCCGAAGAACCAGAATCTCTCGAGTCGATGAAGC
AGTACTTCACTCGTTATCGCGCAACGAGGAACAAGGCGACGAACAACTCGTACACGCACGACGCTTTGCAGCGGTCGTGGTATGCCTTCATCAAGCGTTG
GAAAGCGACGCGACGTGAAGGGACTTCGTTCACGTCCTGGCTCGAGGCGCGCGAGGAGCGAAGAGGGGAGCACTCTATTGGAGAGCTGCGGACTCGCCTT
TGCAACGACGCGAGCAGCGCATGGCGCATCTGCTACgttcatcttcgtgaagGGTGTTCGACGTGTGGGGAGAACAGCGAACGTctcgctcgtgctgcgt
ggAACGACGAAGTTCGTCGTTATCCGCTTGATGAGGATACGCGTCGCTGGATCGGGCGCTCCGAGAGATCCCTCTCGGAGCTGGAACAGGCGAGGCTTCG
ACATGAGCGTGGGCGCTCACGTGGGCGTGGTCACCgtcgcagccgcagtcgcGGACGAGAACGCTACGACCCACTCCAGGACGCGCAGTACTCTCGTGGG
CGGCCGCGTTCTCGAAGTCGTGATCGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGGGCGCCGGTTTCGTCGGTTTCACGTACTGACAGGGCG
TCTCGCGTGGCGCTGCCGGAGGATCACCCGGAGCGGCTGTCGATCGCGCAATATAACATGATGGTGGCCGAAGCGCAGCAGGCGAGAGACGACGCGTTGG
ACGCGTATCGGCTTGCGGAGGACGCTCGCGACGACGCGAGGGCTGCAACGGCGAGCGCTCAGCAGGCGCAGAGCGGACATCGCGACGTGATGGAGAGGTT
GCGGCGACTAGAGACTGCGAGGTTCGGACACCCGCAGCGGAGTCTGTCTGCGCGTGAGCGACAGGGGTTTGGGCCGagtcgtcgacagcgtcgtcagcgT
GGGACATCGGATTACGAGCCCGCCCGCGGTCACGCGGGTGGAGATCGGGGATCTCCGCCGGGTGGTACTGCTTAAGGCGTCCGACGTAGAACGTCGGGTG
AAGACGCATCGCTGTTGGTATGTCTAGCGTGTAGGCGTCTCCGTGAACTTGCTTAACCTTGAAGGGACCAATAAATCTTGGTGCCAATTTGTTTGCACCC
AGGTTAGTCACTGCCGACGACTGGATTCCGGTGGTCGACAAAAGTACTAGATCGCCTTGTCGGAAGACAGAGGTGTTCTTCCGACCTCGTTTATCAGCAT
tttccttctgcttgtccacGGCTGCTTGCAGCGCGTCACGCACAAAACGCGTGACGGCTTGGCGCTGTAACATAAACTCCGACACTGCTGCGGAGTCTAT
CGGGGTTGCATCTGCTTTTGGAGCGAAGTTAGCCACGGGCGACGTGACGCATAGCGTCACGTCAGGCGCGAGACTTGTGGCCACAGGGGATATAGTCTTC
GAGAGTGTCCTCGACGAAATCCCGTTCGCCGCTTCGGCATTGGTACTAGGTACCAGTGTCAGCaagtcatcttcttcactctgCAATAGCGCAGAACGTT
TCGGTGCGCGATCATCTTCTCCCCCACCAAGAGTGGAGCCCATACGATCCGAAGACGTGGCCAAGCCGAGCAGCGCTGGGACGCGTGGATGGCGCGCGTT
GTTGACGAAGAACGGAGTCAGGCCAGTCGACGCATGGCTTGCATTGTTAATGGCGAACTCTGCGATCGGCAGGAAGGAACTCCAAGACTGGAAGGACGTT
GCGTAACTACGCAGTACGTCTTCGAGGACGCGATTAACCCGCTCTGTCTGCCCATCCGTCTCCGTATGGGCCGCCGTCGACATGAGGAGACGCGttccaa
gcagctcaaagagGCGATCCCAAAACGCGGACGTGAAGCGAGGGTCACGATCGGACACGATGGATTCCGGTAGGCCATGATGTCGGAATAAGAtttcgag
gaagaggctggCCGTTTCCTCGGCCGTCACATGGGCAGCGTGTAACGGGACTCAGTCCGAACCTGCTCTCGCAAagcgaagagctggttgTCCTGATCCC
AAGCAGAGGAAGCTGTTCGCAGCACGGTCTCGCAGGAGTGCGAGCCGATGCTGGAGTCCGAAGCGAACGGCACTCGCACAGAGACGAGCCGGATGCTTGG
GCTAGGCCTTGGGTCTTCAGAGCAAGCGGACTCACCGAGTGGTGGGCCGATGCTCGGGGACTTGGAGGAGGCTTGGAGACGACTTGAGCGGTTGATGGTA
AAattgcaactgaattgaaatgagcttatggttcctgaATCCTATGAATAAAACCACTAGGGGCCCTTGAGGTTAAATGTCATTTAACCTACACATGTAG
TAAAGC