Description :
From Genome Similarity Track
Location :
Scaffold_315:370- 2377
Transcript NameFunction/comments
Hyaar_Emoy2813719DEAD/DEAH box RNA helicase putative
Hyaar_Emoy2813720DEAD/DEAH box RNA helicase putative

Sequence
2007 bases(100 bases per row)
GGAAGCAAACCTCGACGGAAGCGTAAATTGAGTGAAGGTGCGCTGGAGGAACAACTTATGGAAGACGAGGCGCGGCGACAAGCGTCGCTACTTCTCGCTC
CGCCTAAATCGAAGGCTAAGAAGTGTGATGCTCATTGTCGTCGGTCAAGCATGGAGTTGGTGAAGAGTAAAGAAGTCTTTGAACAGTCGGATGAAGAAGC
TGCTGTGTCTAGTGAGGAAGAAGGACAAGATGTGGAAGAAGAGGAAGATGAGGAGGAGGAAGTGGCTGTTAGATTGTTCAAGCTGCATGGTAAGAGTGTT
GATGAAGAAATGACTGTTACACAGAAAGTGAAGAAGACAAAGAAGGGTGCAGCGCAAAAAAGCACTGATGATTCTGCTGATCGGTATGTGAGATGCTGCT
TGCTTTCGTATAAGATTTTGGGGTGTTGAAAGAGTGTTTATATATATTGTGTCGATGCTATAGAGAGGGTGTGCGGATGCTCCGACGTCAGCTCGGTATT
CATGTGAGCGGTGTCAGTGTGCCAGTCCCGATTACCTCTTTTGCTGATATGCGCTTAGACCCGGTTTCGAGTGCGCAGCAGATGAAACGTCTGCTATTGC
AAAATATCGAGCGGTCAGAGTACAAGGAACCTACGCCCGTGCAAATGCAAGCAATCCCAAGTTTCTTGCTTCGGCACGATGTACTGGTCACGGCGCCTAC
AGGATCTGGTAAAACCGCAGCTTTCGCGATTCCGATTCTGGCAAACCTGGCCGCCAGCAGCGCAACAAGCAGCGGTATTCGCTCGATAGTGTTGGCTCCA
ACTCGTGATTTGGCAGTGCAGATTCGTGCTGAGTTCACACGCCTTGCAACAGGCAAAAAGATGCACATTACGTTACTGTCGAAAGCCACTGCTGCCACCA
TCGCTTCTCAGACAAAGAGCAAGTTAGCGGTCAATCATGATGTGCTGATTGCTACGCCGCTTCGTCTCGTGCATTTAATTCAGGAGGCGAAGGTCGATCT
TTCGACCGTCGAAATAGTATGTCTGGACGAAGCTGATCGACTTTTGGAGCTCGGCTTTGTGGAGCAGATCGATGAGATCTTCGCTGCCTGTACGCACGCT
AACATCCAGCGGGCCATGTTTAGTGCTACGATGCTGGAAGGAGTCGAAGAGCTTGCGCACACTGTGCTGCGTGACCCAGTTAAGGTGGCAATCGGAATGA
AAAATACCGGAGCTAGCACGATTGATCAAAAACTAGTTTTTGTGGGCAAGGAGGAAGGAAAGCTTGTTGCGATTAAACAACTGTTGCACGACGGGCTCCA
ACTTCCGGCATTGTTATTTGTGCAGAACAAGGAGCGTGCAAACGAACTGTACCACGAGCTGTTGTATGACGGTGTCAATATCGGTGCCGTTCATGCGGAC
CGCACCAAGGAGCAGCGTGACGACGTGATCGCGCGTTTCCGTACCGGCGAAGTCTGGATGCTCATTTGCACAGACCTGATGAGCCGTGGCATGGACTTCA
AGGCTGTAAATATGGTCATCAACTACGACTTTCCACAGGTATGACCATGATGTTTTGCATGTGTTGTGTGTGATATTGCATTAATCAATGTGCTCGAACG
TTAACAGAGCGCTGTGAGCTACATTCATCGGATCGGTCGTACTGGCCGGAATGGACGCAAGGGCAAGGCTGTTACATTTTTTACTGAGGACGATATGGTA
CACCTTCGCACGATCGCTAACGTGATGAAGCTCTCAGGCTGCGAGGTTCCTGACTGGATACTCTCGCTAAAAAAAGCCAGGTATGAAGCAGCTTCTTTGA
TGATACATTTGCTATCTGTTGCTTGACTTACCTTTGTTTTATTGCGGCACCAGTGCGTCAAAAAGGAAGGAGCTGTTAAAAGCACCTCCGATGCGGCACC
GTATCAACACAATATCTGGATACGATCTCCAGAAAGCACACCGGCTGAAGCAAATGAAACATGCAAAACTCAAAGTAGACGGCGATACCAACAACCAGCC
GGAGCCA