Description :
From Genome Similarity Track
Location :
Scaffold_2398:370- 2189
Transcript NameFunction/comments
Phyag_g12430putative polyprotein

Sequence
1819 bases(100 bases per row)
AGAGCACAACCGAGCGGGCACATCCCAAACAACtatggagcagcaggacacCGGCGGAGATGGCGGGAGCGGACACCCGACGTTGAACCCGACGCCGCGG
CTTATCGCGGCGCCTCACACGATGGACACCGAACTCAAGCCGTGGGAGCTGTACATCCTCGACGGCGCCGAAGAAACAGAATCTCTCGAGTCGATGAAGC
AGTACTTCACTCGTTATCGCGCAACGAGGAACAAGGCGACGAACAACTCGTACACGCACGACGCTTTGCAGCGGTCGTGGTATGCCTTCATCAAGCGTTG
GAAAGCGACGCGACGTGAAGGGACTTCGTTCACGTCCTGGCTCGAGGCGCGCGAGGAGCGAAGAGGGGAGCACTCTATTGGAGAGCTGCGGACTCGCCTT
TGCAACGACGCGAGCAGCGCATGGCGCATCTGCTACgttcatcttcgtgaagGGTGTTCGACGTGTGGGGAGAACAGCGAACGTctcgctcgtgctgcgt
ggAACGACGAAGTTCGTCGTTATCCGCTTGATGAGGATACGCGTCGCTGGATCGGGCGCTACGAGAGATCTCTCTCGGAGCTGGAACAGGCGAGGCTTCG
ACATGAGCGTGGGCGCTCACGTGGGCGTGGTCACCGTCGCAGCCGCAGTCAGAGCCGCGGTGGCAgccgcagtcgcagccgcGGACGAGAACGCTACGAC
CCACTCCAGGACGCGCAGTACTCTCGTGGGCGGCCGCGTTCTCGAAGTCGTGATCGTCATGATGGCCGGGGGCAGCAACGTAATCCTCGCTCGTTGTCAC
CAATGCGAGCGAGGCCTCGTAATCCTTCACCACGTCGGGGATATCCTCCATCAAGCGGCTGCGGGGCTCCCATGTATCCTCCGCTGGCGAATATCCCAGC
CAGCGGACCCGGTAATGCTTCCCAGCAGTGGGGATCCGTGTATTCTTGGACCGGAGACCAGGCGAGTGGCGAGCACGCGTGTCGTGATCGACGATGCGTT
CAGCAATCCAGCGTCGGGCACCCGACGCATCGACAAGTGGGGGCGGACCATCGCGACGGAAGGGTGGACTGTGGCGGTGAAGCGACGCTTCAGAGCCAAC
GCTCTGGAGGGGCGCCGGTTTCGTCGGTTTCACGTACTGACAGGGCGTCTCGCGTGGCGCTGCCGGAGGATCACCCGGAGCGGCTGTCGATCGCGCAATA
TAACATGATGGTGGCCGAAGCGCAGCAGGCGAGAGACGACGCGTTGGACGCGTATCGGCTTGCGGAGGACGCTCGCGACGACGCGAGGGCTGCAACGGCG
AGCGCTCAGCAGGCGCAGAGCGGACATCGCGACGTGATGGAGAGGTTGCGGCGACTAGAGACTGCGAGGTTCGGACACCCACAGCGGAGTCTGTCTGCGC
GTGAGCGACAGGGGTTTGGGCCGagtcgtcgacagcgtcgtcagcgTGGGACATCGGATTACGAGCCCGCCCGCGGTCACGCGGGTGGAGATCGGGGATC
TCCGCCGGGTGGTACTGCTTAAGGCGTCCGACGTAGAACGTCGGGTGAAGACGCATCGCTGTTGGTATGTCTAGCGTGTAGGCGTCTCCGTGAGCTTGCT
TAACCTTGAAGGGACCAATAAATCTTGGTGCCAATTTATTTGCACCCAGGTTAGTCACTGCCGACGATTGGATTCCGGTGGTCGACAAAGGTACTCGATC
GCCTTGTCGGAAGACAGAGGTGTTCTTCCGACCTCGTTTATCAGCATtttccttctgcttgtccacGGCTGCTTGCAGCGCGTCACGCACAAAACGCGTG
ACGGCTTGGCGCTGTAACA