Description :
From Genome Similarity Track
Location :
Scaffold_2356:370- 1891
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2356-snap-gene-0.2Amino Acid/Auxin Permease (AAAP) Family

Sequence
1521 bases(100 bases per row)
TCATTCTCGAATTTGCCTCCTCCTGCCCACACCAACTCAGTCTTTAATCCCCATCAATCAATCAACCAGTCAACCATGGGTGGTAAACCGTTTCTCACGA
TGGAGGACGCCAAGATCGCGTTCAACCTCTTCTGCTGCGTCTACGGCATCGGTACCCTCGGCATGCCGGCCAACTTCTCCCGCGCAGGGCCGGTCATCGC
GGTCATCGCGCTGCTCTTCATGGCGTTCGCGAACGTGTACTCGTCCGTGGTCTGCTCCAAAGTGATGCTCACAGCCCCGAAGTCGGTCAAGACCTTTGGC
GACTTGGGCGAGTGGTGTATGGGCAAGACGGGCCGTTACGTGGTCGTGGTCTCCCAAATGGGCGTTTGCCTGCTCGTGCCCTGCGCGTTCCTCGTGCTCG
GTGGCACGCTGCTCGATGGGCTCTTCCCGGGCGCCTTCAGTTCCAAGACCTGGATCATCTTCATGGCGCTCATGGTGCTGCCCGTGTGTCTGATTCCGAC
TCTCAAGGAAGGCGCCGGTGCCGCATTCGCCGGCTGTCTCGGCACGATCATCGCCGACTGTATTGGTGTCGCTGTACTGCTCCATGGCATGAGCGGCCAC
CCGTCGGTCCCAGCGCCGGCAATCTCGTTTAAGCAAGTGGCCGCGACATTCGGCAACCTGTCGCTCGCGTTTGGCGCGGGCATCGTGATCCCAGCGCTCC
AGCGCCAGCACAGCGACCCCACGCGCATGCCTCGCGTCGTGTTCGTGACTATGACGTTCATCTCCGTGCTCTTCCTGGCGCTTGCGAGCTCCGGGTACTC
TGCGGTGGGCTGCCAGATCAAGGGCAACCTACTCTTCACGATCTACCCGGATGCTGTCACGGGCATCACGAAACTCGGCTTCGTGGCGGACAAGGGTGCG
GTCGTACTCGCGTATCTCTTCATGCAGTTGCACATCACGATCGCGTTCGCTGTGCTGATCTCGCCGGCGTTCTATATCGCCGAGCGTCTCGTGCTGGGCA
TGCACCCCAGACAGCCTGAGGAGATTGAGGTGCAGAGTTACGACATTGCGGACACCCCGGCGATGCTCAAGTCGGTCACGTCCAAGTCGTCGGTCATCTC
CATGGCGGACATTGAGCGCGAGAACCTGGACGACGACGACGAGAACGAACTGGCTGAGTACAAGGGCGCCTACGTCTGGAAGTACGTGCTGCTGCGCATC
GTGATCATCGCGTGCCTCGTCGTACTCTCCGTGATCCTGAAGGACCACTTCCTGGACCTGAGCGATTTCATTGGCGCGTCCTGCATCACCATGAGCTGCA
TCATCCTGCCGNNNNNNNNNNACGTTCTACCTCAAGAAACTCTGGAACAAGGTACCCCTGTACGAGAAGGTACCGGCGATCATCGTGGTGGTCGTCTGCC
TCGTGCTCGGCTGTTACGTGACCTATACCTCGGGCAAGGCGCTCTTCAACCCGGACGAGACCGACCCGGAGATCCTGTTCCCGTTCTGCCATCCAGAGGA
CCAGCGCGCGGTCTACTACAA