Description :
From Genome Similarity Track
Location :
scaffold_886:370- 1651
Transcript NameFunction/comments
Pl_101984hypothetical protein PHYSODRAFT_485200
Pl_101985hypothetical protein PHYSODRAFT_480540

Sequence
1281 bases(100 bases per row)
TGGCAAACTGGATAAACCTTTCTCGTGGGAAATACCAGACACTATGTTCATTGACAACACGCGCGTCCAAGCATTTCTGAGGTGTCCTGGAAGTACGATG
ACTGCATCTGGGTTGGTATACTTCAGGAACTTTAAGCGTGCTCAACGCTGGACGCGCCACACGCAAGAAAATGCATCGTTCGAACTGAGAGCAGATGGAA
TTCGTTATCATTACTAAAATGCGTCGGCACTATGAAGAACAATAAAAACTAGCGAAGGGGTTCAAGACTGAGAAGGAGATGTTTGCAAAACGTTTTAAAG
ATTCTGGTAATTCTGCTTTGATAGGCATAAAAACGCTCCCGAGATGACAAAGATGGAAATGTTGCAATGGAGTAAGCTCAGTGTAGGGTGGTACCCCTAA
CATAGGCGATTTACATCAGTTATCTCATCAGTTGAAGTTATGGTAATGAAGTTTATGTTCCAGTCACTGGAAGGCTGCAACCAAATTCGCAACTGTTCAC
TATGTGTGCAAGATGACTAAAATTTCCTTTGGCAGGACAGTAGCTAATTTCTACAGTCTACAATTTTTATTGTTCACGCAACTCACAATAGAGACACAAA
GATGGACAATAATATTCGAAAAATTGGAAACAACAGTCTCACAGAGTCCAGATTAAGTACCATTCTTCTGAAAATTTTAATGCATTTGAGTATCAACGTA
CTCCACTCCATTGTTTGATGTACTATTATAGTTGTTGTTATATCAAGAAGGTATACACTTTGTGAGGAAGATGGTACATACATAATCTCCGAATTGGTAC
ATTGCCACGTTTGTGTGAAGGTCGTAAGAAAATGTTTTGCACGATTTCTCGTGGCTACAGGGTCGATGTTGGTTCAAGGCGCTACGGTTATCTGTCAGCC
ATGATGTTCTCAGAAACCATTTTCGAGGAAAAGAACGGTTGTGGATTTTCCTAGCAATGTACAAGCAAGTGATTCTTCGTAAGTTTGCATCAATCCATCG
AAATAACTTCACATGAAGTTTTTTGATTGAAAATGCTACCACAAGTCATCATGTTTTTGTTCTTTCTTCTCATTCTGCAATTTTCTTGGAAGACATGACA
TCAAGTAGTTGTGACTCTACGATGTCTTCTTTTAGGGAAGATTTCGACGATTCTTTGTTCCCTTTTGGTGGTCATGGAGATGGTCCTATACCATCGAGTG
CTTCATGTGCCAAGATCAGTGACATTCTTGATTGTGCAGGTACCGGAAATTTGGCTGCAGAATGTTCATTTGGAGGTGCAG