Description :
From Genome Similarity Track
Location :
Scaffold_157:37- 3233
Transcript NameFunction/comments
Hyaar_Emoy2811425hypothetical protein

Sequence
3196 bases(100 bases per row)
CCCGTACTGGTAGTACGGCCTAAGGCGACCGACGTAGAACGAAGGATTCGTGTGCATTTCACGTGGCAGTTCAATCGTATATACGTTGCCTAGGCGGAGC
AGCACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTTCCCACGTTAGTCACTATTTGTCGAGGTAGGTTTACCGTAGATATTAAGATCAAGA
CTCCTTTATTGAATAAAAGAACATTTGCCCTTCCACTCTTGTCAGCGTTTCATTTTTTCGATCTACCGCCTATGCGATAGAGTCTTGTACGAAACGGAAA
ACCGTTTCGCGAGCCAGTATGAATTCATCTGACTCACTGTTTTTAGCTGCAGTGCTCTTGGAGCGTACTGTAGCAAGAGCACTTGTCGCCTCTGTGAGTG
TGTCTTTGGACGTACTAGGCGTGATGCTGATTTGATCAGTATCGTGGCCGGTAAGAGCATCTTCGCTCTTACTTTCGACTTCTTCACCAAAGACGATGTG
ATCGACATCGGCATCGAACGTGGTGACCTCATAGTCAGCACGTGAAGAGTAAGAGCCGGATTGGCGTTCACTCGAATGATTCCATCCCCCTTCAAATAAG
AGTCACACTCTAAAAGGTGGGAAGACGCGGATGGCATACGCAATTCACGAAGAAAGGCGGGTGCGTCGTTGACGCATGTACCGAGTTGTCGCTAGCGAAT
TCTACCATCGGCAATAATTCGCTCCAATTTATACAGGAATCAACATATACTCGAAGGATCTCCTCGAGGACACAATTGTCGCGTTCGGTCTGACCTATTT
TAGGTTGGTCAGGTGTGGACATCTTTAAGTGCGTTCCAACTGTTTTGAACACGGAATGCCAGAACACGACTGTGAATCGCGCGCGTTGGGCATACGCAAG
TTAACGAGGCAGCCCATAAAGGCGAAAGACCGTGTCGATAAAGACACGAGCACAAGCCGATGCGTTGATTGATTCAGGTACAGCAACCAGATGTACCATC
TTACTGAATCTGTCAACGATCACAAGAATACCAGTATTCTTGTGAGAGTCTGCGGGTAATCCGAAGACAAAGTCCATTGAAACGGAATCCCAGCACTCTA
CTGGGACGGGCAGAGGCTGCAACGGAGCACTAAAGGAAGGATAAGATTTCACCCGTTGGCAGACCTCACAGTCCCGAACGTACTTGCGCACGAACTGATA
CTGGCGGGGCCAGTAAAATTCGCGGCTCACTGTGGGATATGTTTTTTCACGACCACGATGTACATTAACAGGTGCGTCGTGGTACTCATACATGATATGC
AATCGCAGATCACCATGATTGAGTAAGACGACACGAGGTGTGTCGCCGGCAACAGCCGAATATTGGAGTAAGCCGTTGCGAACTGTATATCTATCCGTAG
AGGATCGATATACTGATGACGACTGTTTGAGGCTCTTTTCGGATGGGTGTGAGAGATGATGCATCAATCGCACCATTCCCGGATCATACGCCTTTTGTAT
GTCTTCCAATAAGGTTGACGACAGGAAACTCGAAGTCAGTACCTCGACAGTGGTCGGACTAGTGTCGGGTGCCGCAGCCGGATCGAAATCGGGCCGGCGC
GAGAGTGCGTCAGCGACGACGTTGAGTCGTACTGGCTTATACTCGACGAAGAATTTATAATTCGCAAAGAATGACAGCCACCTCGCCATCCGCTGCGGGA
GGTGTGGACTGTTTGCGGCCGTGTGCATGGCCGTAAAAACGATGAAGGGTCTATCACCTAGCAGATAGACTCTGAAATTAGCCAGCGCGTACTTCATGGC
AAGGAGTTCCTTGTCATGGACGGGGTAGTTGCGTTCAGCTGGTTGCAGCTGACGTGACTGGTGACACCTTCGAATGAGCTCTGGCAGTCGACACTCCATT
CCCACCTCTCGTTCTTTTTCAGTAAACGAGAGAGATGAACAGTCATCTCGGCGTAATTGCGTGAATATTTTGCAAATACGCCGCTAGGCCAAGGAAATTT
CTTAGTCCCTTTCCATCTGTAGGAACCGGCCAGTCGGTGATCGCCTTGAATCTTTTCTGGATCGGGCCGGACACCATGCTTGCCCACGATGCAACCAAGA
AGTGATTTTCGCTAGCAGCAAATATAAACTTCTTGAGGTTGGCGTACAACTTATGCTCGCGCATTAGTGTAAGAACTTTTCGGACGTGGAGTCGATGCAC
TTCCACATCCGTATGTCCATCCATAGCCCGGCTTTGGACGAACAAATCATCGAAGTAACTGTGAGCGAACTCTTTTATCGATCTTGATAAATTCGTTACA
CATCTGTCGAATGTGGTAGGAGCAATGCTTAATCCTGGTGGCAACACTAGCCACTCCCAGAGCATAACGCTGTGGTGCTCGCCGCTTTATACGGGATGTA
CTTTTCGCGCCAAAGGATCTGATAGAATTTGTCCATCAGATCCATCGATGAAAAGATGGTACTCTTTGTCACACCATCGATGATGACATCTTTCCTTGGT
ATCGGCGTTCGAGCCAGTACAGTTGCAGCACTCAGCTTGTTGAAGGCGTGTACTATCCGCCACCCTCCTGAGGCCTTTCACGCATACGTAAGTATACATG
ATAGCACGCGTAGACATACAAATACCAAGTCACAGTGAGTGAAACTCCCGTGCATCATCGATATTCTGGATAAAAGGTAGACAGCACCCGGACTTCCCCG
GTGGGAAGTCCGGGTGCTGTCGTCGACTCCCTCACATGACCGGCTGCTAAGCGATCTGCAAAGAATTTTTCGATCGCTAGTACTTGTTCACGAGGCAGTG
GACATTGCTTCACAACACAGTACTTCGAACCTGGTCTCACGTCGATTTCGTGACGAGTACCTTTGCCCTTAGGTAACTGGCACGGCACTGCTTCCGGGAA
TACATCCCTGAATTCTATCAAATCATCATAGAAAGGATTTGTTCAAAGCGATTCCCACGATTGGAATGTATATCGCTCAATCCGAGTCTTTTCATCAAGG
ACAATCTCGTCCATTGATGATCTACTGATAATTCTTTCATCTTCGGCAAAGTCCATTGTTGATCGGATATCACTGACGTACTCATCCTCCGCGACGAGTA
CGTAGATCTGCTTGACTTTGCCACTACGCAGATCACGCAACAACCTTTTTGGTTCAGCGGGGGTAACCGAGTGATCTCCAAAGTTAATTTAGGAGG