Description :
From Genome Similarity Track
Location :
Scaffold_3217:37- 3168
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3217-snap-gene-0.1Conserved gene of unknown function

Sequence
3131 bases(100 bases per row)
CCTCGCCGCCATACCAGCGATACAGGAACGTCGAAAAGCCCGAAACCTTCTGGCAGTACATCTCCAGCCGCTTGGCGGCAGCGCTCTTCTCAAGACGCCC
CAGGATGTAATCGAGCTTGGCAAGATTTTGTTCGTCCTCACGATACTCCAGGAACACCATAGCCTCTTGGTACTCGTACTCCTCCGCGAGCTTGACACAG
GCTTTGAATAGGTCGCTTTTCTTCTGCATCGTCCAGGCGTTAGCTCCTTCATCCTGGAGAGGCGAAAACTCGAGCGGGGACTCGTAGTCGGTGGCAATAA
AGACAAGCGGGTTCAAAGTCAATCGCTTGGTAATGTCGGCTTCCTTGCGCAAATCATCTGCCGCCTCGCCAGATATGCCGGGAAGGAACCGGCGGTAGGC
ATCGAGCAAGAGTGATCCAAGTTTGAGCGTCTGATCGGCAATTTCGAAGATTTCTTCGCTTGTTGCAGCCAGGGGCTTGCTCGATGGCACAGGCGAGTAC
CCAACGGCGGATGATAACCGAGAAATCTGATCGGCTATGGCTTCACGAATCGGTCGCGTAAACATCCAGTTACCGGTAGACCCGAGGTGCGTGGCAGTGG
GTGTCTTGAGTAGACTTTGCATACTGTACCCGCTCTCGAGAAGAGCGTACAAGAAGTCGGAATTGCCTTCACCAGATTCCGTCGCCAGCTTCTGAATCTC
AAGGCTGAGTCCCACAAAGAGCTCATTGATCTTGGTAACCTCGCAGTAGAAGATATCAAACGAGTTGTATCCAGCAAGCCGGAGCTGTTCCTTGTCGTAC
CCACGACGCTGAACCGTCCTTTCGATGGCACGAAGAAGAAGCTGCCCGTCAAGCTTGCGTTTGACTCCAGCGTCTGGTCCTTCGTCGACGCGCGCCGAAA
TTGATCCTTGAAATTTGCACAGCGCCACCGCGGCATGGAGCTGTCCTTCGCCGTCAACCAGGTATTGCAATAGCTCTTCCGATGATGCAATGAACTGCCA
TGCATCGCAGCACTTCTGTTGCACAAATGCTACGAACTCTTCAAACCGCGACCGCTTTTGTTCGAGCTGGAAACGCACGAGTTTCGGAGTCACGATGGCC
GCATTCGCCGTCTGTTTGGCAAGTTCTTCACTTGCATCTGTACCCCATCGAAGGCCTGAGGAAGCCTTCGCATCTAAGATCTGAAAAGCTACACCCACAG
CCGCTTGCGCAACATTCGAAACGTCTCGCGAGGCAATGCGAAGAGGGCCGCCACTCTGGGAAGACATGGCATCTTCTTGGAAATAGGAGAGTAGCAGCAC
CGCATACTCCTCAACGCTCAGATTCTCACCAAGCGCGTGGGACTCGGGCGTCAACTGATCTGAGTCTTCGACGCGCTGCTTGCGACGCGAGGCCTCCGAG
GCCAAGGCAGCTTTGTTGTATACGCGTACCATGTTCGATGTCGTGGCCGCGCACACCATACCACTACCTCCACCAGACCCGGAAGATTCGTACTCCATCA
AGAGAAACGAAACCGACCCCTTGACCGCGTCCGATGACTCGGCGCTGACCTCAACACGAGGCGCAAAGCCAAGGGCCGCGTTGCGCTCTACACCATGAAG
AGAAAAGTCGGTCGACCTCACAGTCGTCTGGCCGGGCGCCGGCAATTGGATCGATGAGAAATGCACTGGTTGACTCTGGACCCACACGAGGTAGAACGCC
GCATTGTTGATGGGAACTGTCTCAACGTCAAAGTACTCGCTGCTGTCCACATCCTCCGAGAAAACGGGCTCATAGTCAAGGAAGCACGCCCACTCGGGTT
CTGGTTGACGGGTACGCGAGCCGTTTGTCAACTTGAACTGGAAGAGCGCGTACTTGACGCGTGGTGTCTCTTCATTCGGTGCCGTGCACACGTACGCAAC
GACGAGACCGAATGTCGACGCATCTGGGATGTAGGGGATCGACACCATGAATACTCGTGCGAGATGCGAATCCGGAAAACGCTCGCTGAAGTACTCAATG
GCGGGGCGGTTGGCGTCAAAATGCCACACGGTCGTGCTGGTGCAGTCCATGGCGTCAATCGAGTTGAACGAGCGGCGCTCCATCGAGCCGTCTGAAAAGA
GCAGAAGCTTGTCGACGCGCTCGTCGGCGTCGTCGTCCACGTCCGAGGTCGAGAGAGACGACGGCATGATCTTCACGGCGTGGATGGGAGCGCGTGGATC
GATCTCGGTATCTGCCGAGGATGATGCCGCACTGGCAAAGAAAAACTGGCTGACAGTCTTGGTAAGGCCCGACAAGAAGCCTCCTTGCTGTCGCTCGAGC
GAGCGCACGCGGATGCGGCGGTCCTCCATCGCGACTTCCCACACGCTGCCCTGGTTGCTCCAGCAGAGAATGCTCTTAAGTTCGTGGTCACTAGGTGTCT
CGCCGGCAGTCGCTGTCGCCAACTCGCTCGTCGACGGCGAGACCGTGAGGCTCGCGTGGGCGTTCGTGAAGACGAGCTCGTGGGGCTGCAGTGGGATCTG
CACGCTCAGGGGCACGCTCTCGTAAGGAAGCTCAATATCCTCCCAGAACAGGACGCGACCGTTGCGGCTCACGACCATGAGCGACACACGCGCGCCGTAG
AGTGCAAACAGAAACGGGTGGAGCGGCTCCTCCGGCGCGATCTCGTCCGGCAGCGACAGCGTCACTACGTTGCCCGAGCCTTCCTGCCACAGCACGAGCC
GCTGCCGCAGCACGACCACGTAGTACGAAACGACGTGGCGCTCGCCTCGGCTGGAGGGCGCCGCAAACGACGCCACTGCGTGCTTGGTTTGTGTGGCGAC
AGGCACGGCGACGCGGCAATTGACGACGTGGCGCGCACTCGGACGGTCGCGGCGGATCTCGTCGGCGACCATCGCCGGCACGCCGCGCACGCGTGTGACG
ACGCACTCGGGCGTCTGCACGATCACATTGCCGCCGTCTTCGACGCGCTGCAGTTGCGCCGGCGCTGCTGTCGCCGTCATGCCGTGCGAGCGAGACGAGG
ACGTGAACGCCGCGACGTCGGCCCAGAGCTCGAGCCGCGGGCGTTTCGACGCCGAGAAGTCGAGCACGGGCACGCCGCCCGAGGCGTTCGGGGATAAGAG
CGATCCGTTGCCGCGCTTGCTCGGCGGCTCC