Description :
From Genome Similarity Track
Location :
Scaffold_2202:37- 3167
Sequence
3130 bases(100 bases per row)
CCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTAGATCGAGCCCGGAGAAACCTGGGAACTGCAAGATCGGTTAAAGTGGGTGG
AACATGAGAAAATGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGA
CAAGAGACTATTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAAGACAGTATCCCTAGGCGACCTAGATATGTGTCAGTGGGATCCCGTCGT
TAAAATATTGGCAGAATCTGCCGTACGAGGCGACTACCGAGGTCGAATCTCTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCG
GCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAGT
CGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCAAAAGCCGAGCAGCCGAACCCCGCTGATCCACAAGTGGATCCAAGCTCTCCAT
TGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGCGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGGTGG
TTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACG
AAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACTGAAG
AAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGAT
TGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCA
CCTCAGTTCCGGGAAAAACTATCGGATCTGATTAAGGGCCTGCTGAAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCA
TCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGTCTCTAATCAATGA
GCTGTTGGAAGATTTGGATAAAGTACTCTGGTACGGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCC
GCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTGATCGATAACGCCCTCT
ATGGATTCACCGGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAAATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAAC
CCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCG
TGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGAGGAATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGA
CGAATCCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGTAACCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTT
CATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAA
GCTCTGGCCCGGGAGATGTCGGATCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGGGACCAACGGA
GAGAGGATCCAGTCTGGATAGAAACGACGGATCGGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAG
GATCGCGACCACGCCTATCCGCCGTCATTCCAATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACTGGGCAATTTCAGCAGCTCTGGTACAA
GAACATGAGGGGATCTGTCATCCAGTCACCTTCGTTAGACGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGGGATACTCGCGCTCC
TGCGCGTGTTGAATCTGAATTACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTT
ACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTAGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGTCC
GCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTAC
AGGCAGATGAGGATCTGTACGGCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACCTGGATG
GGAAGCTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGGCTCCTTCTGGGTTTGGATTTACTAAAGGGACAA
GATTTAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGC
AGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACAAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGCTTGGCCAGTGCACGCGT
TTACGGAATCAATGCGGCGTTGAAGTGGAG