Description :
From Genome Similarity Track
Location :
Scaffold_2873:37- 2742
Sequence
2705 bases(100 bases per row)
TCTGCATGTTCCTTTTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTCAAAGAGACAAAGTCATCGACTTGCTTGC
GAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCACCAAGCCCTGAGCCACTGCGTGGCGGCGTCAGTGGGACGCGAGGGTTAAC
CAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGC
GCCTCAGCGCATACGCTTCGGAGGGTATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTCCGCCGTGGACATGTCCAAAC
GAGTGCCGAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGATCTCGATCCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGAC
TCGGTCTAAAAACAGCAAAGCTGTACCTTCACCATCAATGGTGTCCGGCACTGCCGCTAAATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACTATA
CCTGTGTTTCCCGCCTTATCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAGCATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTG
CCGTGTTCGGCGGCGGACTTTGTCCGGTTGACACGTCTCACACGTGCGTACATAGGTGGCGACCCACTTATACATCTTGGGGCACCAGTACATCGAGCTC
ACCGAGACCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTTTAGATCCTTCATCATGAAGAAC
GACTACACGAGGGTTATCATCAGCGTCGGTGCTGTAGTACCAGCAGCCACCATCGAGCGAGTATCGATGCAGCCTCGCGCGTAAGCGCGCAGACAATTCC
TTGTCAGAGTTTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACGTGTCGTCCTGTGCATACGCTCTGCGTATCAAGTCAGGCACTGACG
ACGTCACTGTCGTGACATGAGCTAATTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAATT
ATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAATGATGAGGCGACTGTGTCGCAGTGCGTAGCGACGCATGATCAGTAAAGATCACAAAA
GGCTTGCGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAG
CTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTTTGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCGAAATCGGAGGCGTCACAGACGACGCTA
AACGGGCTATCCGGGTCCGGTAGTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGAAGTGCGTAGCGACGCATG
ATCAGTAAAGAGCACAAAAGGCTTAGCGCCTAGCAGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGT
TTTTCTCTGCAGCTTTGAGCTGGCGAGACTCAACGCAATCACGCATTCACGCCCTTTGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAG
GCGTCACAGACGACGCTAAACGGACGATCCGAGTCCGAAAGCGCTAATATCGGAGCCTGGAGGAGGCTCTTCTTTACAGCCTCAAAGGCACCGTCGTGCT
CGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAATTCTGATAATGGCCGAGCCATCTCCGCGTAGTTCGCGCTGTACTTGCGCAAGTAATTGGCTAA
GCCTAGTCACTTGCGTAAGTCTTTTTGGCTCTTGGAACCCGGGCAGTCCACGATGGCCTCGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATG
AAGCACCCGAGGAAAGGTATTTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGT
GGTCAATGTGGTTTTCCACGTCTGACCTTCCGTGCTCAGCACGACTATGAACGAATATATCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGGGCCTAAA
CAACTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCTCTGGGGCATCACCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCT
GTCAGCGGAATGTCGCTCGCTCTCATGAGCAATTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAACGTATAGCCTACCATGTTGTTCTGCAGAA
CATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTTAGCTTGTTAAAAGCATGAACGATGCGCCACTTGCCGTTCGGCTTTCTGACACA
GAACGTGGGAGTCGAGTGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCACACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGC
AAAGG