Description :
From Genome Similarity Track
Location :
Scaffold_949:37- 2713
Transcript NameFunction/comments
g16628.t1hypothetical protein

Sequence
2676 bases(100 bases per row)
GACCGGCGCAAAACATGATCTTCGTGGCGATCTACGTCGACGACTTGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAG
CAAGCGGTTTGAGATGACAGACCTCGGCGAGCTGGAGTACTTCCTCGGGATGGAGATCAAGAACGCCCGCGACTCCGGAAAAGTGACGGTGCGGCAGACC
AAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACGCCGGACTCAAGCTGACCAAGAACATGTGTG
AGGGTGGCTGCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGC
TGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACCTGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACG
CATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGCTATTCGGATGCGGACTGGGCCGGCGATATCGAGTCTCGACGGAGCACAAGCGGCT
ACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCGACGGAAGCAGAGTACATGGCGCTATCGGA
GGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCAGTCAAGATCTACGAGGACAACCAAGGCTCC
ATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGC
TGCAGTATGTTTCGACAACCGACATGCTGGCGGACATGATGACGAAGGCAATTCCTGCAACGCAGTTCAGTGTGCTTCGGAGCAAGCTCGGGATCCAAGG
TGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGAC
CGCAATCATTCCTGTGTTGACGGGACGCTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACA
AGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAA
TCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTCACCGAACCG
TCTTGGGTCGACGAGGCTGACCTCAACTGCGGGGCTTTGATGCACGAGTTTGAGCGCGAGCGTACTAGACGGAATCGCTTCGGAGTGATGCAATCGCACG
AGGCAGAGGAGGACAACTCGTAGTGATCGCTGCGAGTTGGGAGTGAAATAGGTGCAGGGTGGCTGCACTTAGGAAGAAGGAGGGCAACTCGTGGCGATCG
CTGCGAGTTGAGAGTGAATTGGGTGCAGGGCGGCTGCACTCAGAAAGAAGGAGGAGGTATATGTACAAAAAACAAGTGGCGTGAAGGGGGAGAGAACCGA
TTACGAGGTTCGATCGACCCGATCAAGGAAGACAACTGGAGAAAAAGAGGTGAAAATGGAATTACATACAGACTAACACTCAAGTGTACGCTTAAGGGGA
AGCTGGGATGACGAATTTGCTACGAAGACGCGCAATGCGTTGCGCGGGATGCGATCGGATGTCGTGGCGGTATTGGACTCGCCAGGGCTCAGCCAAGTCC
GCCTCTTGGACTGCGGTGATCAGATTCGTCGCCTGCGAGTTGCCGTGCTGCCCTGGATACCACATCTTCTCCTCACCCGGCCGAGGTCGGTGCATGATGA
AAGGATCGAGCAGAATGTCCAAATCACACCGACCCTCGACCAGTCCACGCAAGATCGTCCGAAGAAAGAACTTCCAGCGAGCACCGAATCGTGATTGCCG
CTGTTTTCGGGTAGCGGCGAGAGTATCCAGGTAAACGTCCCCGCGACGACTGCTGGTGCTGATGGAGAAGTAGTGCAACGACTCCCACACGGCCTGTGCA
TGCTCGTGTATCAGGTCCGCATATTGACGAGCCATGGTTGCAAACCAACCCACGAGTACGAACGAAATCGGGGTGACGGCAGTGTGGAGAGTCTCCCAGG
GGCGCGTCGCGTACAACGCCCGGACGTGAACCGCGGTGATCAGATCTGACCGCCAAGCATGATCACGTGGAGCACGAGCTGCACGCTCAGGAATCAACCA
ATTACGTGGCCGACAGAAGTGATGGAACAGCAAGTCCAAATCCAATTCGAGGACACTGATACGACGCATGTATCGAGCGTCCCACGGGGCGACATCCGCA
GCGGGGCGTCGCACGCGCTCGCGATATCCAGGAATCCATTGATCTCGAGGCACAGTTGTGCCTTCCAAGCGATCATACTCCTGACGCCCCAGTATAGCAT
TCCGATGCGTACGATCGCGACGGGGTACGCTGCCGTCACTGCCTGAAGAGCCAGGTGAGCCACCACCAGGTGGAGA