Description :
From Genome Similarity Track
Location :
Scaffold_1:37- 1800
Sequence
1763 bases(100 bases per row)
TCATTGCATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCGCTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACG
GAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGC
CGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCATTCCAAGC
GGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCT
TCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGA
CGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTT
CGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTTCACA
AGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGA
CAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGATGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGG
TGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACA
AGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCTTTGAGGAC
GGCGACTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAAC
GTGCTTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTATGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGG
ACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATA
TGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGCTCGACATCCTCGCG
GAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCG
CCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAA
GTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAGCACCGGAATTTT