Description :
From Genome Similarity Track
Location :
Scaffold_262:37- 1553
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_262-snap-gene-0.10Brix domain containing 1

Sequence
1516 bases(100 bases per row)
CGGTCATCGTACCCGCCACGACGGTCATCACGACGGTCGTCGTACCCGCCACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGTGGGCGTTGTCCCGCTCGCGTCCGTCATCTATCAAGAGAAG
TCCAGGAGGCGGAGCCACATGAGCTTTCTCCTCACAAACCGGCACAGACATGCTTCACCCGTACTGTCGCGGCGCTGCTCGTGCTTCTCAATCTCCTCCT
CGCCAAGGGGCTGCTTCTCCTCCACCCTTATCAACGCAACGGCAGCAGCGTCAGAATCGCGTGCAACCAAAAGTCTGCTGACTGCGACCGACGAGAAGGC
GTCTCTTCCAATGAGAAGGCACTCACGTCTCAATCTTCGGCGCGGCCGGGATCGGCTGGAAGTCGACGTCGTCGTCGTCGGCCCATGACGATGAGCCGCC
GCCGCGGCCGAATGCCAAGTTCTGCGCCATTGTTGCGTGTCCTGCCGTGCACGTTCCGTTCCCTCGTTTCAATGATGCGCCAAACTTCGTTCAGGTGGCG
ATTTTCGAACACCTGGTTCTTAACCGCTCGGTGTCGGGTGTAGCTTTTCGCGTTTATACTGTGATATTATATGATCCATGGGGCTGACATCCCATCTTCT
CTCGATTCTACCAATGTCGTGCGGAGCGGAACAGAGCTGACGAGTCGTACGGGCTGATTCTGGACGCTCAACGCGCGTTACCCTTTGCTCCTCCGCCACC
CGCTACGACGTGCGCACTGCCAAATTCCCTACAGTAGCGTGCAGTGTGCTCTTCTGCTTGCATCGGAGGACTGCATTTGCACGCTTCGAGGCTAGAACGC
ATTTGATACGTTTCACAACTTAACCGGCATTCAACCAGCACCAACCAAACACCAGCTGTACTGTATACACTTCTTATAGTGGCCCTTCTTGCTGAGGTGA
TGCGCGCTTGACAGCGCTTGGCCTTGGACCAACAGATCAACGGCGCGTCAAGCAGCAAGCGGCAGCAATGGGCGGCGGCTCCAAGTTGATCAAGGCGACG
GCGGGGAAGCAGATCCAGCGCGCAACCAAGAAGGTGACCAAGAATGCGGCCAAGCAGAGCCGGAAGGTCTCGAGCGTCACCAAGCCCAAGCGCGTGAAGG
CTCACGTGCAGCGCGCAATCAAGGACAAGGAACCCAAGCTGGTCGAAAACACCAAGAACCTGCTCGTGATGCGCGGCAACAAAACGAACGAGGAGGTCAA
CACGCTGCTCCGCGACTTGGTGCGTCTTCAGGCCGGCCGACTGTTCTGGTTGTATATGCAGTGTGAGCTGACTGTGGCGTTTGGTATTGTTTGTCGTCGA
CCTTTAGCGCATGATCAAGGCGCCGGACGCCAAGATGATGGGCAAGAAGAACGACATCCACGTCTTTGACGACGAGAACCAAGTCGAGTTCCTGACCCAG
AAGAACGACGCCAGTC