Description :
From Genome Similarity Track
Location :
Scaffold_1700:37- 1458
Transcript NameFunction/comments
Phypl_g13989hypothetical protein

Sequence
1421 bases(100 bases per row)
GGacgcagaggaagaaggacaagcgTCATTCGTTGAGTGCCTCCAGAAGCGTCGCCGCTTGGAGGAGCGGCAGCCGGTGTAcgacttgctgtcgacgatT
CCGCCCACGTCGAACGTCGTTGAGAGATTCTTCAGTGTCGCTGGAACGACGTTTGGCCGGCAGCGCCATTCTCTCCAGCCTTAcacgctggagatgctgc
tgttcagCGAGTACTGGGACTCGCGTACCATGGACAGCGTTGTGTAAGCGGCACGTAACTTCGGATGTGAACCAATAATCTATTTCTTGGTGCTTTGCGT
AGCAATAATCTATTGTGTCTCTGTCAGTCCCTGCATAAATAGTTTATTCCACGTCGTGCTTGGCAATAGATAACAATGCAATAATCGGGGGCCCTGCCCG
TGAGCGCAAGCcccgccgccatcgccagccAGTCTCTCACGGTCGCGGCGCACCGCAAGCGCACCAACAAGCGACGCCAGGAACAACCAACACATCTAAC
CCCCACCATCACGCCTcgcatcctcatcgtcggAGATGACCCCTTAGGCATCGGCGCGGCCCAGCCGCTGGCGGCTGACCGCACGGCCAACGAGTGCACT
GTGGTACTCGTCCTCGAGAAATAACGTCCAGCTACCACGCCATGGGACGCCGCCTACACCAAGAAGATCTTCGTGCCAGCATGACCCCGCCAACGGCCAA
GGCTTTCGTCAAGAGCTAGCGCGCCGTCGTGACGTGCCGTGCCGGGTGCCAACGAGATCGAGTTCGCTCTCatcggcgaggacggcgacatGCTGGTGGG
TCCCGTCCAGAGCATGCCTTACGACTACCTGGTGGTGACCTCGGGCAGCACGTACACGGTGCCCATCCAGTAGCCCAAGAACAGCATCAAGCGCGCCGCC
acgaaggccaagctggccgaggtgcGCGAACAGGTCAAGACCGCGTCAGGCGTGCTCGACGTGGCTGACGACATCAAGACGAAGGCCGCAAGGCAGACCG
CGACGATCCCCGAGGGCACGGACAAGCTGTGGCCTCGGGCAACAACATGCGCGACAAGTTCCGTGCCAAGCTGCCCACGTACGTGTAGCACCTGGGCGCC
TTGGTTCTACAgcggtgctgggcgagaGCCTGCCGGATCGCCTATCGGGCAAACAGCTTCGAcaagcgcacgctgcgcgCGGACAAGGGCACGGAGATCG
AGCCAgacgtgctgccgctgtgtGGCGACGTCAGCCCGACGACGGAGTTCATCCTGGAACTGGGAAGCGGGCCTCGTGACGCCCAAGGGTTCCATCAAGG
CgaacagcaagctgcagctggataGCAACCAGTACTCGGACATCTATGCGATGGGCGACGCGAGCAACATCTCGGTGCCCACATCAGCCTGCCCTCTCCG
GATACTCAATTTAATTGGGGG