Description :
From Genome Similarity Track
Location :
Scaffold_9:37- 1374
Sequence
1337 bases(100 bases per row)
AGGACTTGTTGAAGTACTTCAAAGACCCTTCTGACAAGGCACTGCAGAGCTTGCCTGCTAGAACAAGATCGCGCGTTCACCGCTTCCGAGTACACAATGG
GTTGTTGTATTATGCGGTGGAAGTTGAGGATACAGCACGAGTTGTTGTTCCCAACGATGAAGGTTTACGTCATCGACTCTTGTATGAGTACCATGACAGT
CCTTCGGGTGGCCATCTCGGACGTGAGAAAACGTTTCTCAGTCTTTCCCGGGATTATTACTGGCCACACATGTACAAGTGGGTTCGCAAGTATGTGAGAA
CTTGCGAGATCTGCCAGCGTGTGAAGCCATCTGGCTCCACGCAAGCCCCACTTCGTTCATTGGCTGTCCCATCGGACAGTTGGAAGTCTGTGAGTATGGA
TTTCATATTCGGACTTCCTCGTGACAAACACGGACGCAATGGCATCCTTGTGTTTGTGGACCGATTCAGTAAGATGGTCCATCTTGCACCGGTTTCGGAC
AAGATCTCAGCCGAAATGACGGCCAAGGTCTTTGTAGACGTTGTTTTCCGTCTACATGGCCTACCAGTCGAGATCGTGTCTGACCGTGACACTCGTTTCA
CATCCAAGTTTTGGCGTGCACTGTTCAGACTTCTGGACACCAAGTTGTCCATGTCAACAGCAGCACACCCGGAAACGGATGGTCAAACTGAACGAGTGAA
TCGTGTCCTGGAAGATGTATTGCGCAGCTATGCAACATCTTTCGGAGAGTGGAGCGAGTTTCTCCCTCTCGCTGAGTTTGCGTTGAACAACTCCACGCAT
GTCTCGACAGGTCACTCTCCATTTTATGTGAACTACGGCATTCATCCCCGAGTGCCTGCTTCCATAATGGGTGAGGTCTCTACCTTGAGTGGGGGAGGGA
CTACGGCTCTTGGAAATAAGCCGCAGTCAGTCACTGACCTGAATGCTGTTGCCGAGTTGAAAGCCAATTTCGACTCGATGAAACCTCTAAACGACATGAC
AAGTCGTGAGGCACAGCAAGTCGACGACTTTATTGTGAGAAGACAAGCCATTGTAAGGTTTGTTCGAGACGCAATTGCAAAAGCTCAGGATCTGCAAAAG
AACAAGCAGATAAGAGTGGAGGAAGACAAGCAAGTATATAAGGTCAACGATCTTGTATTGCTTAGCACGGCTAATCTGCCTGAACATGCAGTGTCCAACT
TGGGAAGTTCGAAACTTTTGCCAAGATATATTGGACCGTTCAGGGTAGTTAAATGCAATGATGATGCCTACACACTAGACATACCTACACGCATGCGTCT
ACATCCTACATTTTATGTGGGTAGACTAAAGCCTTAC