Description :
From Genome Similarity Track
Location :
Scaffold_666:3699- 9510
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_666-snap-gene-0.9Ribonuclease P protein subunit p14
Pytap_DAOMBR444maker-pag1_scaffold_666-snap-gene-0.10Syntaxin 72
Pytap_DAOMBR444maker-pag1_scaffold_666-fgenesh-gene-0.1Mitochondrial Protein Translocase (MPT) Family
Pytap_DAOMBR444maker-pag1_scaffold_666-snap-gene-0.7Nipped-B

Sequence
5811 bases(100 bases per row)
TACGAGACTCGTACTTGTCGACTGACACTGGATACGAGCGAGGCATGAGTCAGATCAGCACGAGGTCTGATGACGACGCGTCGTTCTACATTGAGGGTCG
CCGGGAAGACCAGAACGTGCAAGCACGCCAACAGGAGCGTGAGAAGATGGCAGGACCACTtAAGTTGTAGGTGGAGTTAAGTTAATGAAGCACGAAAACA
AATGCAGTCATTAGATGtATActcGGCTAAGATACACTGCGACGATGTCACAGGAAGCGACCAGATGCAAGACCAAGAAGCGACGAGCTCACATGCAGCA
CCTGAAGCTTGCACAGCTTCGAGTCGATTGTCGTGCACATGGTAAGAGCACCCCAcACGAACTGCAGCTGGCTGATGCACACACACAGGCAACAAGACGT
GAGGTCAACTGTGTAAACGGAGAGATCGTACTTGgCAGCACCTGTTGGGAaCGCGCAGGATGGCAATTGCAGCCTCCTCTTTCGACGCcTTGGATAGAGA
AAGCAAGTCAAACTCGGCCTTtGCAGCGCCGACCTCTCCGAAGATCGCGCGCAGTTCGTTGTTGAGCGCGAACTTGAGCCGTTTGACGTCGGTCACGATG
CTCGTCCCGTCCTCCGAGATGCTGAAGCTCGTATTCATTAGATCAATTTCCTAGCGGTGAACTCAAGTAGCAACAATACTCACATAGCTACCTTGATAAT
GCTATGGCTGCCACGCAGCGAGAACTTGTGGTGCGGCCcgTCGGCGGCACCAACTGCCGATGTCGCACTCGCCATTTGCACTGGGATGTTGCGATGAGCT
CCTGGGCAGCAGCGCTTCAGGTTTCAAGCAACATTTCCGCAACATTTCGTtCACATAGTCAAATTGAGGCAACATGGGTGAATCAGTTGCGAGGTTGAGA
TGGTGGTGGTGCAACACGAACAGCTCCACAACGTGCTGTGGGGGCCATCGTCTCGAGAAGGGCGCTCGAAGCGTGCGGACGTGGTCgCCTATGTGCAACT
GGTAGAGTGTCTCCTGTTACGCCTGAGTTGATTAAATCGGGTCTCACGCAGtACGTGTCTCTCGGCAGGCGCTCGTGACGGCACTCGGTGTTTGGCAAgT
CTTCGAGTACGACAAGCCTGTGGCAGCGCGCCTAGCTGCATGCGGCGGCGCATATCTTCTGTACTTCCGAAGTGTGGGGCTGGTAGGTCGGTTTTtGTGT
GACCCTGTGTTCCATGCGCTGACAGAGTTGGCATCCAGTTCCTTCGACTCATAATGCTGCTGTCGCTGATGATTGGATATGGCGATATTCTCGTTCCCAT
GCGCCAGCTTAtcGCgTCCGGCAATGGATTCTCGATGCAGCACGTACCGATTCTTGTATATGCGATGCTTCTGGTCAACAACGTacGTTTGATGCATCAT
TTTCtGTGCTAATTCACCTGACTAACATGGACACTGTAGGCAAAGCTGgCGTATCTTACTGTACgCGCGATGCCTTCACGCTCTTCGAAAAAAaTGGCTG
TTCCGAAGAGAGTGATCaCTCGAAAGCCtAAGGCAGCATGAAAGTAACAATAACGAGTgtttGAaCAAGATGTCATATCATAGATTACGGACAATCACaC
GTCGTCAGTCCCCGCCTGCTTCCaCCTAACTTCCAGCCACGAGGAGGAAGATGAGGATGGCAAAGAGGATGAGGATAATAACGTAGAGCTTGAAGTTACT
GCTcTGTCTTGCAACCTGAGCTGCTCGGGCTCCTTCGgTCTCGAGTCCATCGGTtGCGCGAGAGACATCATGGTCAATATCATCCAGCAATCGCACGTGG
AGAGCTGTTTCGTCTTTCATCGTCACGCTATAGTTCTTCAGGTTGGAAACGCCCTTGCTGATTAAGTCAAGCTGCTGGTCTTGGTCTACAGTAACATCAT
TgTATAAGCCTCCACGTCGTGCGCTTGAAATACATCCGCCTTCCTCACCTTTCATGATCTGCGTCTGCATCGTCAAAAGCTTCCCAGCCTGGTCTCGAGG
CAAGTTGCTGCATGGCAGCACCAGCTTgaGGATCAACCAAGATATTAGCGTACAAGGGTACTTCAACTCACTTGCTTCCATTCATCGCACTGCGCTTGTT
GTACGCGTCCATATCGGATTTCTACAGCGCGAGCAAACACCGTGATCAGCTCGTGTCCAAGTGCAGCGTACCCATCCAtcGTTTTCGTCCGCACCTGATC
CTGAACAAGCTGCTGAAGCAGTCGCTCACGACGGTCCATCTCCTGCTTTGTTCTATCGCCGCCCACACACACAAGTCAGGCCACCGCACTTCACTTTTtC
CtCCcTCcATCCAAaGCCACTCACACACTGGAGCcTGAGGAGCGTTTGAGTTGGTCGAAATCaCGCTTGAGCCGCGACACCGtcTGCTGCAGTGCGAAga
CGCTCGTGCCGGCCGCCGCACCATTGCCCGAGCGGATCTTCGACGCCAACGCGTTCTGCTGCCCTCGCGCGCTCTCCAGACGGTCGAGCCACGACGCCCA
CGCCGCCGAACTCATCCCGATACTCGGATCTTCCACAGTCGGTCGCTGCTTCTTCACTTCCCGACTTCCAGGGTCTAGTATTGgaTGTGGCGTGGGTGGT
CCTTTtCCGGGACAATGCGGGACGCATGATCCCTTGTTGCAGTGTCTGTGTGAGGGACTTCGgaGCTCTTGGACATCCATCACCCGAGGAATTGCCAACA
CCGCACGACACCAAGGTCctCGTGAGCCAAGATGAGCCAGCGCGAGTTCGAACGCAAGATGGAGGAGCACATCGAGGAGATGCGCGTGACGCAGACCATC
GCGTACTTCAGCCGCACCGTCGAGCTCTGCTTCAACGAGTGTGTGCACTCGTTCCGCAGCAAGAAGCTGGATGACAAGGAACTCTCGTGCGTCAACGCGT
GCGCTGAGAAGTTCCTGCGCCACACCATGCGATCGTCGGTCCGACTGCAGGAAAGCTACGCAGAGATCATGCAGCAGCAGGAGCAGGCCGCGCAGCAGCA
GAAGTAAATAGAGGCTCAACCTGGCCATGAGCATCcTACAAACAATTCTAAATATCACCCTGCCATTgTGGTCTCTTCAACGCGCCACCACTGTACAGTG
CCTCGCACTGCATGACAAAGCAaGTGTGCGTCTCATATGCACTGTTTGCTCCTCATGAAGCAGTCCGAGTGTCCTGCTCATAGCGGATCGTCATACAACC
CGACCtGGCGGCGTTGAAGCAACCTTCGTGCAACATTTGGGTCGGCGCCAACTACTCGCCCTGTTATTCAAAGGGCAACGCCACCGACCAAAGCAAGTCG
ACCGCTAGTGAGCCCTCGTGGCTCCTGTATCTCCACCTACAAGACCCACAACGAaGAGCAAGTACCACCAGACGTTAGCGCACATCGCGGCGCGCCTACA
GCTGTGAGCAGAATGCGTGGAGCGTCCGATTTGTtCCCGATACTCGATCTTGAAGGCCGCCATGGCAACGGCAACTCGAGAGCAGAGGTCGTTCCAGTGC
GTGCGgACGTGCACGCAATGCCTCCTCCGCCTACCGACGATGAAATAGAGCGATTGCGagTGATGCTCAGCAATGTGCCGAGCGAGATTGTGTGAGTGGG
CGTGTGGAGTGGATCGATATGAGCAGCAACTAACTCGTATTCTACAGTCCACACGACCACCAAGCGCTTCAGATTAaTGGAGACGCCTTGCAGCGCATGC
CACTATGGGCGAGAAACGTGTTGGATGCTACTTCGTTGCAGCCGCAGCATAAGCGACCCAATCCTGAGAGTAGACAGGTCCTTGAAGCGCCACAGCGAAA
GAAATCCCGACATTTGGACAAGAAAtCTAACTTGCGCATCGTAGCTGACGAGCTCAATGGAGAGGTGACGAGCCGCTAGGATCCTCACAAGAAACTGACA
CTGGCGACATCGATAACGGTCCTCTGCGCTCGACTTTTACACAAGAAGAACGCATCGCTGAACACGTAGGCAAGTATTCAAATGTTCTTGAGGCGCTGCT
TGAGGCCGTTCAGCAGCGCCATGACGAGCAAACAAGCGGAAGTTACGAAAGTGCTATGGATGTTTTCTCGTCGTCCGATGTCAAGGAACTGCTCCAGTGC
ATCAAGGTTATGGACAAGAATTCACTCATTGTCAAATGTGATGTCGAGCTCATGATCGCTCTTATGGGAGTCATGGACAAGCAAGTGCAGATTGGACGGG
ATCTGGATGTATTGGGAACGATGAACTTGGAACATGGGGACGAAGAGTGGAAAGCATCGGGTATCGATTCGCGTCTGGTTGCGCGTGTCCAGGCCTCTCT
TGACGTCGCTATTTGTGAGCTGCTAGTCATGTCCACGCCAGACATtGACCGGAGGTTGCTTTCTGAAGAAGTGATTGACAACTGcTGCCTCATTCTCACA
CAAACTATTCAAACACTTGTGATACCATGCATCGATCCATCGTCGTCGATTGCAAGTACTCCAGCATCAGCGCGAACTTCTTTGGATGGGCCAGATTTTG
ATCGCACAACACCAACAAGTTCACGAGTTCGAGGAGCATCGAAAGCCCTCAACATAAAAACGAACAAGAATTTGAAGAAGACAATGGATCGCTTACTGAC
AGTTGTATGTGAGATGATGGAACAACTTGCAAAGCTGATTGCGACTGTGAAGCTGGCAGATCGGTGGATTCTCCGCCTaTCCGCGCTGATGACGAAGATG
TATCTGCTTGAGTTtACCCCCcAAGCTGCTCTTCTGCAACGAAGTAGTTTGGTGGTGTTGAGGTCTATTTtCTGGAGTACAAAaTGCATCGTCCACTCGT
GTTGGACGAAGTTGTCTCCGTGATGATCAAaCTTCCGACAGCcAAGCGCAACTTGCGAACATTTAAGCTTGCTGgCTcGAATGGATCGGTGCAGATGATC
TCAACGCTGGTCGTTGTCCTGGTTCAGGTAACGACGTCGATTACAAGTGAAGGTGTtGCAGCTGCTCGAGCATCACAGAGTGATCCAACaTTGCTCCCTG
ATGATGCTGTGATGGAGgAAGACGTGGAAAGTGAAGAGAATTtGCCACTTGATTCGAATGCAGCACAGCGAATAAATGAAGCTCAATTGAGTGCTAGACA
ATTCATTTCAGCCCTGCTCAAGGAGTGCGTTAAGAAGACAGAGGAACGAGACAACCGAGTTGTGCTTGAAAACCTTCTCGAAGACCTCCTAGCCATGTTC
GGACGTCCCGAGTGGGCTGGAGCTGAAGTTTTGCTTGAGGTGTTGAGTGgCTCCTTGGCGGGAATTTTGAACACTAACCATACCAAGGACTCGAAGAAGC
TCGAGTCCCAGTATACATTGACAGCATTAAATCTAGTTGGTCGCATATGCGCTTCAATTCGAGTTACAAAGAaTGCGGCAGCCCGCGACACGTTTGATGA
CGACGACGCTCGAGtGGTATTTGATGAGCACGAAGCTCACATGAAGAAGTTACTGAAGAGTGCATCTATTGCCAATGGGGACGGAAGTAAACATGTTCGC
GAAATCAGTTCAGACTACACCCTAAAGCACATGGTCCTAACTTACGTGCGGAGGAATACCAGGGATGCGATACAGAACGACTCACAACGTCTATTACTCT
CACGATTCATGGCTGAGAAAAGaTCGCCAGAAACTCCTAAGCACATTCTAGACGTCTGGAAGAAATATTGGAATGCAAAAGAAaGCTCAGGGATTGACTC
GTCATCTAAGATCGCGCCTCTCCAGCACGAGTTAGCTCTCAGAGCAAGTTTCAAGATTGCGGTTTCTCGAGAATTTTGCAAGATGTTTGACACACTCATA
CAACAGCTCAT