Description :
From Genome Similarity Track
Location :
Scaffold_157:3699- 4986
Sequence
1287 bases(100 bases per row)
GGATTGAAGAATTGTAAAATTTACTGCGGAGCGAACTTGGTGCGTGCTGTTGCTGTACACTTCAATCACCCCGAGTTCTTGTCATTATGCGCATCGGTAC
AGCTGGTCTTCCGAGTAATAACTTATTAGGCGCCGCCGACGGCCTCGCCGCGGCCCTAGCGGCGGAGATCAGCGACGCACGCGAACTCGTTGCGCTTCAT
CGTGCTGTAAAGATACTATCGCGCATTTATGAGCTGTTACTTCAGCACTGTTTGGCGCTTGCCCACCTACAGCCAGCCACTATTCACCTGTCGTGAGCAC
TATTCTGCTGTTACTGTTGGTTATCTGTTTGCCTTTCTACTTTCCTAATGCAGTCCATAACATTGGAAAAGCTTTCTCCGACTTACGGCAACAGACTTAT
TCATTGGAATGTTCGGCGCTGGTTTCCGCTTCTGCAAATACCGCGCGACCTTGTTTGCGGGGTTTTTATGCGACAACCAGCCCTCATAACCGTTCACTGC
CGTCTTCTACATGGATTTGTTTTGTATACTACGGATCTTCAGGGGTGTGGGTGGTGATCATTGGTGCCCAGGTGCCCATGCCGCATGAAATTAGTGCTAC
TCATGTCATTATTGCTGGCACTCGCATTCTTGTCGCTGCCGTTATTGTCATTTGGCTCAAAGCAATGCAACACCTTATGCAATTTGCACGAGGTGATGCA
TTGCGCCTCTCTAAGATACTTTCAAGCAACATCTGGAACGTACATAAGCGGAGGGGGCGACAACACAGGTAGCATCCACGTAATTTATGAATTTTCTCGG
GTATTAATTATAAAAGCGCCACTGTACCTCAACATCAGCCGTTTCAAAATATGCCTCTATATATCAATCTATATAAATTACCAGGTGTTTATAAATGGGA
AAATCGGACCTCCACCCGGATCCTCCCTTAGCTCTGAAATAAATTTCAGAAAAAATATTTCAAGCATCCCATGTAAATACACGTGCTGCTGTGCTGCGTC
TCGCATATTGTGAATCTGACTTTGGTAGGAATCGCTTGGCACTAGTCCACAAATGAGTAGCGATAGTAATATTGTAGCACACTCGAAATATTACAACACC
ATAGTACAGTCACACCTCTATAAATGACACCCAGTTCGCTCGGTCTAATACGCTGTTTCAGTTAAATAATTGATCAGATAAAGAAATGGCTACACTTCTA
ATGGCTTCATTTTTATATGTTAGGTGCACAAGGGCTTTCTTTACCTGGTACCCCTCCAGCATTTTCGTACTCTTGTTTTGTTTCGTC