Description :
From Genome Similarity Track
Location :
Scaffold_20:369856- 377531
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007929Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
7675 bases(100 bases per row)
GGAACCTAGGAGGCACGCTCGAGAACGACCACAAAGAGCTTGGCTCTCGTCGTTCTAGTGCTCGCGAGAGCACTACAAGCTTTGTTCGTAGCTGTGAACC
ACGTCGGGAACATCAGACTGAAGAGTCTCTCGAGGTTCCCACGTGTCCGAGTCCGGCGGATAGCCAAGCCACCGTACTCTGTAGAAGCGTTGACGGTTCA
ACTGCTTCTTTCCCTGACGACGAGTCGATCGATCCTCGTGATCGACTATCGACTCAACGATCCAACGACGCTCTCTTTGATGATCGATCAGAGGAGGTGG
GGCTGAACGCGAAAACGATTGAGCGACTCTGGAAGTGGAAGAGTGCTCATCGCGCTCAGATCGAGGCTCTTGAAGTTCGCAATGCGGTACTCGAAGACCG
GTGTGAAAGCCTCGAAGACCGGTTGAAGGAGCAGGAGTCGAAGATCGACTTGCTCTTCGATGGTCTTGCCCAGCGTTCGGCAATGGAGTCACGTTCCGAA
CAGAGGTTCGAGAAGATTCAAGCCGAGCTTGAACGACTCCAGAAGGCTGAGAAAGCTCGTGATGCGTATCACGAACGTTTACTGCGCTCTGTGGAAGAGG
CAGGGACTTCTCTTGAGATACTTCGGAAGGAGTATCATGGTCGCCTTCTCGCGTTGGAGACAATAAAGGACGAGTCCTTTGATGTACTTCAGCGCCTTTA
TGCCGAGAAGAAGCTCCATGGCGATGAGTTACAGACTCTTCGCGAGCTGGTGGAGCGACTTCAGGATCAACTTGATCATCCGTCAAAGGTTCTATAGGGT
TCGCTGACCCACTTGGAAGGTAAGGCTTTAATCGTCCTACGTAGAACGTAGGGTGTAGTCGCATGCGTTTAGGAATGTCTAGTGTGTATGCATCCCCATT
GCATTTAACTACCCTGAATGGCCCAATATATCTTGGCAGAAGTTTCGAACTCCCCAAGTTAGACACTGCATGTTCAGGCAGATTAGCCGTACTAAGTAAT
ACAAGATCATTAATCTTATATACTTGCTTGTTCTTCCTTCCACTCTTGTCTGCTTGTTCTTTTTGCAGATCCTGAGCTTTTGCAATTGCGTCTCGAACAA
ACCTTACAATGGCTTGTCTCCTCACAATAAAGTCATCGAGTTGCTGTGCCTCACGACTTGTCATGTCGTTTAGAGGTTTCATCGAGTCAAAATTCGCTTT
TAACTCTGTGACAGCATTCAGGTCCGACTGTGGCTCCTTAGCCGCAGTCTCTCCCCCACTTAAGGTAGAAACCTCTCCCACTAGTGACGCTGGCACTCTC
GGGTGGAGTCCGTAGTTCACATAGAACGGGGTATGACCTGTCGAGACATGCGTGGAGTTGTTCAACGCAAACTCAGCGAGAGGGAGAAACTCACTCCACT
CTCCGAAAGACGTCGCATAGCTGCGCAACACGTCTTCCAGGACACGATTCACTCGTTCAGTTTGACCGTCTGTCTCTGGGTGTGCTGCTGTTGACATGGA
TAGTTTCGTATCCAAAATGCCAAACAGAGTACGCCAGAATCTGGACGTAAACCGAGTGTCTCGGTCGGACACGATCTCCCAAGGCAGACCATGTAGACGG
AACACCACGTCTACAAAGACTTTCGCAGTCATCTCTGCCGAGATCTTGTCAGAGACCGGAGTAAGATGCACCATCTTACTAAATCGGTCCACAAACACCA
GGATGCCATTCCTGCCGTGTTTGTCCCTTGGAAGTCCGAATATGAAATCCATACTCACGGACTTCCAGCTGTCAGTTGGCACTGCCAATGAACGAAGTGG
GGCTTGTGTGGAGCCAGAGGGCTTCACACGCTGGCAGATTTCGCAAGTCCTCACATACTTGCGAACCCACTTGTACATGTGTGGCCAGTAATAATCCCGG
GAAAGATTGAGAAACGTTTTCTCACGTCCGAGATGACCACCTGAGGGACTGTCATGATACTCATACAAGAGTCGATGACGCAGGCCCTCGTCGTTGGGAA
CAACAACCCTTGCTGTATCCCCATCTTCAACCGCATAGTACAACAACCCATTGTGTACTTGGAAGCGGTGAACACGCGATCTTGTTCGAGCAGGCAAGCT
CTGCAGTGCTTTGTCCGAAGGATCTTTGAAGTACTTCAACAAGTCCTGACATGTGTCGTCAGACTTGTACCCTTCGACAATCTCTTCTCGCACTGTCGTC
GTGGCTTGAACTGCGATCGCTTGAACATCTTCGCAAAGTCGACATTCTTCGTCCAGATTGTCACTCTTGGACTTCGGATCGTAATCCGGACGTCTTGACA
ATGCGTCGGCTAAGATGTTCGTCTTGCCTGGCTTGTAGTGTACAACAAAGTTGTACTCTGCAAAGAAGGAAAGCCATCTCGCCATTCTTTGCGACAAGTG
AGGAGTCTTTACCGCTGTCCGCAGTGATGCGTGATCAGTGTAAATAGCAAAGCGCTCCTCGCCAAGCAGATAGACACGGAACTTGACAAGAGCATACTTC
ATCGCCAGAAGTTCCTTGTCATGAACTGGGTAGTTCCGTTCTGCGGGTCGGAGTTGTCGTGACTGATACGAAACAACTCGCTCTCGACCCTCATCATCGT
GTTGCATCAATGCACAACCGATGGCATAGTCGCTCGCATCACAGACGACATGGAACGGCTTGTCGTGGTCCGGTAAAGCCAACACAGGAGCTTCACGAAG
ACTCCTCTTGACTTCTTCGAACGCCGTTTGATGGTCTTTCGACCACTCCACTCAACGTCTTTCTTCAAGAGCTGTGTGAGGGGTTGCACTAACGCTGCAT
AATTGCGCGTGTACTTGTGCAAGTAATTGGCCAGACCCAACCATTGTCTCAGCTGTTTGACGTTCTTTGGCTCAGGCCAATCGTCAATAGCTTTGACCTT
CTCCGGATCAACTCGAACACCGTTCTTGCCCACAAAACAACCGAGAACAGGGATCTCGGGAGCGAAGAACATACACTTCTTCAAGTTTGCGTACAGTTTG
TTTTCACGCATGACCTGGAAAACTTGACGAAGATGATCAAGATGAACATCAACATCAGATCTCCCATTCGTGGCCTTACTATGAACGAAGATATCGTCAA
AGTAACTCGGTGCAAATGTTCGTAAAGGACGAAGAACGTTCGTGACCATTCGATTGAAGGTCGCGGGTGCATTCTTCAGTCCCTGCGGCATCACTAACCA
TTCCCACAGCATACCACTAGGGGTACTCACTGCAGTTAGTGGGACATCATCTTCGCGCATTCGAATCTGATAGAATCCATCTTTCAGATCGATAGCACTA
AAGATGGTGCTGCCAACCATTCCATCAAGGATCATGTCCTTGCGTGGAACCGGAGTTTGAGCAGGTATGGTCGCGTCGTTCAGCTTGTTGAAAGCGTGAA
CAATGCGCCATCCGCCAGTTGCTTTCTTCACACAGAAAGTGGGGCTGCAATGCGGAGACTTACTCTCTCGCACATGGCCAGCCTTTGCACGTTGCGCAAA
GAACTCATCAATCGCATCGACTTGTTCCTTTGGCAACGGCCACTGTCTTGTGATGCAGTACTTCGTGCCAGGAAGTACGTCAATCTCATGACGAATGCCT
CTATCAAATGGCAATTCGTCCGGCACCTTGTCTGGGAAAATGTCTTCAAATTCCCTGGCAAGTGCATACACGGGGTTGGTTTTGAGAGCGTCCCATGACT
GCTCCTCGAACCTTTCCTTCCGTGTCTTCTCATCAAGCACTTCAGCTTCCATTGCTGATACTGTGCTGATGTCCTCTGCATCGCCAACATCGACGATCAT
GCAGATCTGCGAGATTTCGCCTCTCGCTAGGCTACGCTTCAGCGTCTTCTTGCTCATCGATGGCAAGGAAATCAATTCTTGGACAGAACTTGGAGGATTT
TCCACTTGTACGTGACGGATTACATTCACGTCACCTTCTTCCTTGCAGACCGCGATATTCACAAATTCGCTCGAAGTGACTCTTGCTTGGACACTTCCTT
CGTCATCTTGACTTGTACCTTGATCAGGGGCACTTGAAACTCTTGATGAAACACTCTTCTTGCTGGTCTTCTTTTTCTTGTCTTGGGGCGGGTCTCTGCC
TATCTTCCCGTCATTCTTCATACTACCATCGCACGCAACTTTGTCGTCGATGGCAAAGGAGACAGTCTTTTTCTGGCGCCTGACTGCTCCACCTCCGTTT
GTCTTCTTCAAAATGGGTGCCACTTGTGAACATGGGGGGCCATCGCACACCGCAATATCACAAGGGCCATCTGAGATTTCTTCCACAGATGTATAAACCC
ATACCACTTCATCCGTTGTCATGCTGCTCAAGTCAGCGCTGCATGACTTGTCAACGGAGATCTTCATGTTCATCCAGTCAATGCTAGGTTGGTAACGCTT
CAACCATGGCATGCCCAGGATGATGTCAAACTTGTCATCGAGGTCGAGAAGGATGAACTCGTCCTCGCCTCGGAAATCTTCACACTTCATTGCCAAGCGA
ACGACTCGCTTTGGCATCTTCACAGTTGACCCGTTGGCCAACCGAACAATCATCGTCTTCTCTTCATTTGCAACAGGCACAGAGATGTTGTGCCTGGCAA
TCACTTCATTTCGAACAAAGTTGTTCGACGCACCAGTGTCAACCAAAGCTCGTAGAGGCGTTGCAATACCGTCTACATGAACTTTGAGAACGATCAAACT
TGACGTTTGACTGACACTCTTCTCACTCGTGGAAACTGCATGTGCATCATGCACATTGGGGCCAGAGTCCTGTGTTTCCACAACATTCACAGTCCTCTTC
TCGAGCCCAGTAGGAGGCCCCGCCCCTACTGGTCGTTCCCGTTTTTTGACCTTTGGGAACGATCGAACCGACGACCATTATTACGGTCGTAGTTGTTCGA
GCGCGAGCCCTGTGCCGTTTGCCGATCAGACAAAGACACTTTGCAGTTCCGAGCGAAGTGACCCGGCTTCCCACAACGGAAACACTTTCCATCGTTGCGA
GGACGTTCATTTCCAGGCGTGGAAATGTACGAGATGTCCATCGGCTCTGGGCCATCATGAACAACGTTTGGTTGCCTTGGTGGTCTTGCCGGAAAACCTT
GGAATTTGGCTTGCTTGATGCTGAATTCTTCTTGCATCGCACGGCTGATGGCTCCTTCCAGGGTCTTCGGGTACTCACGGAACAGCTGGTTCCGAATCGG
ACCATCGTTCAGACCTGTCATGAACGTCACGACTTGCGTTGGGATGTCAATCGGCTCGTCCACGATGCTCGATACCAAGTAGCGAGCTCGTTGTGCGTAC
GAGTGTAGGTCGTATTTACCCTGACGAAGCTTTAAAAACTCTGCGCGAGCCCGAAATTCGCTCTGCGGAGGTTCAAAAGCCTTCTTCAGCTCTCGCTTGA
AGTCGTCCAGGTCGTAGAAGCAATGTGGCTCCGCCAATCGCTTCCCATACGCCCAACTTTTCGCTCGACCCGCAAGTTTTGACATTGCAAACAACACTTG
CTGTATTGGGTCCCGTAGTTGTCTTGCAGTGATCGCTGCATCCAACTCAACGAACCATCTCGCTAGAGGCTCGTTCTCTCCGCCACGGTACGGAGATACA
TCGAGCTTCAGAGGTGCTACTCTCATCGTCGTGACAGGAGTTGCAGACTGTCGATGAGAGTTCATGATCTCGTGATGCATGAAGCTCGTAGCCGCGTTCC
TCTGCTCAACCGGAGACGCTGATTTCAGCAAGCTGATCACAGCCGCCTCACCGATGACCGCTCGCATACGCTCGAGGGCTGCCCACTCGTGGCTCGACAA
ATGAGGAAAATGCTCATTCGTCAGCTCCACGGTTTCTCCAGGCATCGAGCCCATCGGCGTCTCAATCCCTTCCATTGTTTCTCACAATCGGACAGGGGTC
TTGGAATGTCTGCGCACGCTACACAAGCGGCCTATGCAGACTCTTGACGTGGTCGTTGAAAGGACTACGAAGTGCTACCAGGTGTAAGAGGCTATCCGAG
ACAGCCTCAAACACAGCACGCACGCTTGCGCTTGAGAGGAAGACTTGGGAGGAACTTGGAAAAATTGCAACTGAATTGAAAATGAGCTTATGGTTCCTGA
CACTACATATAAAACACCACTAGGGCTCCTAGAGGTTTTACTTGTAAAACCTAAACATGCAGAAATAAAACCTATGAATCTGATATATAAAACCTTGGGT
ACACTAAGGTTGAACCCAGGGGATCTGCTGGAAACTTGAACTTGAAGTACCGCGGAGATTCCCTGCAAAGTGATTGGCGGAAGCCATCACTTCAGATGGT
AGAGACACGTTGATCTCGTCACCAGTGTGGTTTCCCCAAGTAGGAACCATCATTCACATGTCTAGAGTACTCTCGTGCATAATCACGCCGAATCTCAATG
ATTGCGAGCGATCAACACTCAACTCAGACACAGATTGCTCTGACATCAGACGATGACGTCACCTGTGCATATGGGATCACTTTTATGTGTTTCACCCAAT
ATCTTCGCACCCACAATGCACTTCCACAAGGTGGCGTGTGACACACACAAAGAGCCACCTTGCATGTAATGGCAGTCTTAGCCCATTACAGGACGCCGCG
ATGGATGTGCGATGGCGCGTTGCCCACGATGAGAAGAACTTGGCGCTCTTCTCGCTACATTCTCTCGTTGAAGTCCAGCAGCCATTGTTGGTAGACGGTT
GCGGCCATCCAGCCCTTCGACATCCCAACGTACTGGACGTTGACGAGCTTCTCTGACAGTCAGCGAGGACGCTTGGCATTGCCGAGGAAAACAAGCGGCA
TCTTGTCCGAGGCATCAGAGTTCGCGCCAACAATCATCGTTACTCGGGCTTTGCTGAGCTTGAGTGCCGGCGCCTTCTTCATACAAATGGAGGAGCGAGG
GACTGCCTTGTAGTACAGGGCAGTCTCATCCATGTTGTATACATCTTGTGGTTGGAACTGCCCTATACGTTCTCGGAGCTGCGCAACGTACTTCAGCGCT
TCTTCCACATTCACGGACCCAATCTCGCCATGCGCTCGCTTGTGGCGAAAGTTGTGGCGAGCCAAAAAATGGCGCAGCCATCCAGATCTCGTGAAGCGTG
GCCGGCAACGCCGCGGAATCCGTAGCTCGTTGGCGAGCCCAGCACCAACCCGTATGACCTCCCTGCCAGATATTGGCGTCTTCGACAGCTCTGCTTCTAT
CACAAATTCAGCCACAGCCTCGTCGAGGCGCACCATGTGGTGAGAGCGGAGTCTCATCTTGGACAAGCAGTCGCCAGACAGCGTTGAGAGCTTGGCCTCG
TGCTTCACGATGTCCAGGATCGTCGGCTTCCCAGGGCACTTGGTCAAGCAGAACGTGACCCGAACCCACTCTGCCAACTCGTTGTACGTCCACTCGGGAC
ACTCGCTGCGCTTCTTGCAGATGAGTAGATGCTGGTGCTTCGTCAGTCTAACACGAGTACTCATGTCGACGGCGCGTCTTGCTTGCTGATTCTGTGTGTT
TCTTGTGTGTCTTGTATGCTTCAAATTGACAAATGGATGCATGGATTCAAAGAGCGCATCAGTTGAAATGAAGAGGGCACATGATTTACCGCCCATTTTT
AAAATGTAAAAACCTAAGCTATCTTATCTCAGTGCATTTGCTGATTTACCTGTATGAACTTTTTCCTTGTCGATA