Description :
From Genome Similarity Track
Location :
scaffold_180:36975- 43020
Transcript NameFunction/comments
Pl_108175hypothetical protein PHYSODRAFT_555414
Pl_108176hypothetical protein PHYSODRAFT_312032
Pl_108177hypothetical protein PHYSODRAFT_486347

Sequence
6045 bases(100 bases per row)
TTATACAACTGCTCCAAAAAATCGTCTCTATCGAGATCCTTGGCACCCAGCCCCATTTTGTAGTCCATGGACATGCCTAAATCCCACATCTTGAACCCTG
CTAAGTACAAAAACTTGCTCAGAGCATGCAATTGCACTGTGCCTGCTCCGTTTGCTCTACTAAATCCCGTCAAGCTTGTGTAGACGCTACCCACTGTGTA
TCCAAGCTCTCCAGCCACTAGCGTATTCGTAGCCACGTCATAGAGCTCCACTGTGAAGAATCTGACCTTTTGCCCAGGATAGAGCTCGATTCCGTCGTTT
CCAGCTTGAAATAAAGTCTTGAAGCTCTCAACAATAGGTGGATAGAGCCACGGAATGCCGTGCTTCTCATGGCATCCTTCCACAACAGCGTCGAAGTCTC
GATTAAGTACGAGTTTGAACTTCTTAGCCCGTTTACGGACAATTTTGGGCACGTGCTCGGGTGCGTGGGGCTGGATCAGCAGCACGCAGCGCTGGCGGTG
TAGCTTGGGCAGGAGAAAACATTGCCCCTGGAAGTCCGAAGCGATGGGAAGGAATCCCTCGTACATGAGATGGCTCAGCAGCAGTGGGTCGAAGTGGCGC
GACACGTAGAAGTCATCTTGTGAGTGGAACACAAAGTGCCGCAGGTGCTGGGGCACGTACTCGGCGTCTGAGCGCTGTGGCCGTCGCGCTGGCGACATTA
TGATACACAGTACGAGGAAATGAGCCACAAGTGGTGTGGTACACAGATTTTGTGTCGTATACAATGTTTTGGACAATCATTTCGACCAATCCCGTTCCAA
ATTCATCATCGACGTTCGGATTGGCTGAAATCCCTTTATTGTCACTTCCGACATCGCCATGATGGAGCAGCGCGCAGTAGCGAGCGTCCGCGCCTCCATG
GACTTCAACGGGCCTCTCAACGCGCTGTCCACGTCTCCAAACAACCGCTTGATCGCTGTGGGTGGTAGAGATGGTGCGTCACTTTGTTATTGCTGCGCTG
CTTATTGTTATAATTGCTTATTGTCAATTTTGCGTCAGTGCTCAAGGTGGTGGCGCTCGAAGCTTCAGGCTTCACGGAGAAACGCAATCTGCGCGTAGTG
GGCAAACCCAGCCTAAATTTCAGCACAAATGATATTCGATGGCATCCCCGTACGTCCTGCAATTGCAACACAGGACAGAGATGAAGTTGGTACGAATTAT
GTGATACTATGCAGAATCGGATTATTTATTGGCGACAGCGGCAACCAATGGCGCTGTGGTGATCTGGAACTTAGAGCGAGACGGATATAAACACGTCCAA
GGTGGGAGGGATTAAGGGGGTTAGATGTTGATGATATCTGATGACTTGTGAGTTTTGGATTGTGGTTGAGTAGAACGTGTGTTGAACGGACATCGACGTG
CAGTGAATCGCATTTGCTGGCACACAACAGAATGGAATGTGCTAATTAGTGGATCACAGGACGGCACGGTGAAGCTCTGGGTACGAATTTCTGCTGATGG
CGTTTCGGAAAGAGACTAGACTAGCTTGAAACTAATGTGATGTGGTGACGGCTGTCCAGGATAAACGAGGAGGGAAAGTTGTATCAACATACCAGCCTAA
GTCGGAGAGTGTGCGTGACGTGCGTGCAAGTCCATTTCACCCCAACAAATTTGCTGCTGCTTTTGAAAATGGCATCGTACAGGTGTGGGATATGCGCAAG
AATTCACAGCCAGAACTTAAGTTTACGGCGCACAAAGGATTGGTGCTGAGTATTGATTGGCACCCTACGGATGCTAACGTTTTGGCTTCTGGTGGACGCG
ATCGTTATGTGAAGATTTGGGAGTTGGGTGATGTCCGACAACCGAAGCAAACAATTCAGACCATCGCGAGTGTCGGTCGTGTGGCTTGGCGGCCTACTTG
TGTTACGCATATTGCTACAAGCGCATCACTTATGGATAATAGCATTCACGTTTGGGACACGAAGCGGCCATTCATCCCTGTGGCATCAATGAAAGGCCAT
TCAGACATTGCATCGGGAATTTCGTGGATGGATACGCCCGTGTCACCGAATTTTGGTCAGCCGGAGATTCCTGGCGATTGGGAAGGGCATGACTACTGGC
AACATATGCTAGCTTGCTCGAAGGATGGTACCCTCAAGTTGCATTCGCTCGCTGACTCCTTCAAACCTCATCAGTCTCTGCCGACCACAGCACTTGCTCT
TAACTCTAAAGGACAGGTCGCGTTTTCCCACGACTACATCGGTAAGAAAACATAGTTTGGGAGAAGAGCTTTCGTCACTAAATTTGCTTCTGCGATTACT
ATTTGCTCTGCTGTTTCTATAGATCGTTCATGTGCATCTCTGAAGATTCACCGCCACTTCAGTTTGGGCAGCTCGCTCTTTACAGTTGCTGGAATATCCT
CCTCCTCCCCAGCTCTTGGTTCATCAAATGGTGACCGGAAACCAGGTAACGGACCACTCAATGTGTCGTCAAGTCCGTACCACGGTAGCTCCGAGAGCCC
GGAGGATGTTAGTGCTGGAGCAATGCAGGAACAGTCATCTTCACGCACTACCGCTTGGTCTTTCAGTACAGGGTCGCAGCAACCTCCTCTAGTACCCAAA
GGATTGAACAGGTCTGGCGGTAGCAGTGCGAATTTGACGAATTTATCAAGTGGAGTATCATCCACAGGAACTAGTTTTAAATCGGCTGGGGGAAGCAGCA
GTCTTAATGCAGCAAGCGGGGTCGGATCAGGAGGAATCGCTCGGGGGTCTGGACCTGTGTCTTCCTCTCAGCCTAACCTGCTATCGTTGCAGGGAAGCAG
CAGCACTGGAGCGGGAGGAAACACGTTATCAGATGGAAATTTTGTGTCGGTGTCAAACGTATCAGCTTCGCTAGCATCAGCATCGCCCGTAACTCCGATG
ATGTCTGGCTCGGCTGTACCTCGTGCGCTAGTGGCGCTTGTGACAATGCAAAACGTAAGCAAAGCGAGTCAGCTCGAGAAAATTTTCTTGGGTGATGAAA
GTGAATACGTGCAAGCGGGAAAGCAGGTTGAGGCTTTGCGTGCTCAATTCGAGCAAGGTCAGTACCTTAAGGAGTCTTTTGGGTTTGATGAGCACACGTT
TCGCTTCTTGGCCAAGCATTACATGCTCTTCCCCGAGGGTGGTAGCAGTTCCAGCGGAACTGGAAGCTCTGTGGATTCTGTTGCAACAAAGGGTGGGGTA
AGCTTTGCTCAAATGTGTGCACATAACGCTTTGGCAGCATTTGTCACCGGAAATGCACACCTGTGCCAGATGTGGCGTATCTTAGAGGTACTTTACACAA
ACGAGGATGCAGATACCACTAAATCCAAGCATGGCCAACGAGTGGTCAGTAAGCTAAAGACCGACCAACGCTATGCTGAGGGTTTTAGCCCTGAAGGAAG
TCAAAGGGGTGTACCGATGGACGGGGATCTCGACGAAGAGAATCGTGAGCGATCGCCAAGTGACAATAACCATGACGATCAAGTCAATGATTTTGAGCAC
AGAGACGACCGACAAGATATTGATGAGTTTGGGCATGATAGTCATAGTCACACGAACCATGGTCATAACAACAACGCGAGCGAGACTACAATGCTACTTG
AGCAACTTGACCACGTCAACCCACAAGCAATGGAAGGATTCGATCCGTATCCGTATGATCCTAGGGGGAGACATGCTAACGAGAACGGACGTGAAGGTGG
AGACCGAAATGGAACCTCTGGGGTGACAAATGTACGTGGTAATTCATCGATGATCATGAATGGAAGTGCTGTCATGGGCGATCTAGGCCATCTGCGCGAT
GACGTGCTAAAAGAACTACTAGAGTACTACACGGAAATTGGCGATCTGCAGTCGTGTGTTGCCATTACTGTTGTCGTCGGGAAAGTGACTAGTGTCGAAA
AAGTTATGGGCAAAGCGTGGTTGCAACACATCTATATGCACTATATCGATCTTCTTCACCAGCTACAAATTTACACGACGGCAAACGAGTTGGTCGCGAA
CTGTTCTGACCAGTCAATACGTCAAATGAACATGGTAAGTCTGTATAAAACCGCACTGCTGCTTGAGTCGCTTGCTGGTACTGAGATTACTAACTTGTTT
TACTATTGCAGAAATCCACAAGTGTTTACTTCAATTGTGCGAGGTGCTCTAAACCACTCGAATCGTCTGGTTCAAGCGAACTTAGCGTACCAATGTCTTT
ATGCGCAAACTGCAGTAACGCCGCGACACTCTGCTCGATCTGGTACGAACCACATTTGATCATACTTTTTAAGACTGCAATGTTTCTGACGTGATGCACT
GTTTTCTCGTATTCTGTAGTCAACTGCCAGTGCGGGGTCTCTACGTCTGGTGTCCCGTGTGTGCACACGGTGGTCATTTGGATCACCTAACTGAATGGTT
TGCTCATGAGACTGTTTGCCCAACTGGCTGCTCCCACCATTGCTCGTTTATTACCATTGATACTGCGATGAGAGAGTAAGGTTATATGGAATTGCCACAC
TTTGATTCACGTGTGAGTTTTTAAGTGTGAAAATACCACACACCAATCGAGACAAAAATGATTGTCGTTGTGGAGATCAACACGTACACTATCTCATCAA
AGGATCTTGTAGTTACGTCAAATATTACCGCTGAGTTTGACACGTTCATGTTCGTACTCGAGTCTAGTGAATTCCTTGAGCCAAGAAATGTTTCAAAGGG
GGTGTTCTGCAACCATCCTCGAAGTGATAGTCTAGTCATGGCAAATCGAAGCGCCAATTGTCTTTCTGTTGCCCCCGACGACATCTCCAGTGCGTGATGA
TAGTATCGTTGCGCTCGTTCTAGATTTACTTTGACACCATCACCAAATTCATACATGAAGCCGACATTGTAGGCACCAAGAGCATCACCCACAGCGCTTG
CTCGACTATACCATCGAAGAGCAGTCTTTGGATCCTTGCGCATTCCTGCAAGCCCATAGTAGTGATAATCTCCAATTCGAACAAGAGTTTCTCTGTCTCC
ATTTTCACTGTATGCCAAAAGTAAGTATTTGAGCGCTCGGCGCTCACTTGTTATATCTCCTGTTCGCAACCGACATTGGTCATAAAGGAAGGCTAAATTG
CTAATAGCAACTGGGTATCCGAGTTCCCGGGCTTCGTGGTAATAAACAGCAGCACGTTCAAATTCACCGTCAGTGTACAAGTCAAAACCCCTCCTTACCG
TGCGCCCCCATTGACCTCCATCCGACGCTGCTTTCAAATACTCTAACGCCCGTTCACTATTGCGTGACACTACTCCAGGTACCCCATTCATCAAAATCTT
TCCCATTTCAAAGATGGCATCGAAATGTCCAAATTTTCTTGCAGCCACGTCATAAAATTCCATAGCACAGCTTAAATTGACGTTTGTACCAAGACCCATC
GCATGACAATAGCCCGCGTTGAAAATGCTATCACCGTCTTCTTCGTTTTCCGCAGCACGCTCGAAGTACGCAAGAGCAAGTGACTTGTTCTCCGGAAGAC
CACCACTACCGTGGAAGTGAATAAAACCTAAACCATTCAGCGCTCGGGTGTTATTTTTCTCTGACGCTTTTTCGTACCACTTGATAGCGGTGCCATTATC
CTGAGCAGTTCCTTCTCCTTTCAGAAGCATACCTGCAACCGCAGATTGCGCATTTACGTTGCCAGCTTGGGCAGCTCGATTAAAGTAGTTGTAAGCCTGA
GCGTGGTCACGTGACACTCCATGGGCACCCCAATAATAAAGATCCCCCATCGCTGCCATCGCATCCACTTCTCCATTGTCCGCACGTAGCTTTTGAAACT
GAATTAGCTCGTCATCGTCTCCCCGCTCACCAACAGTGATATCCCTCTCAAAGGAGTCATATAGTCGTGTCATTTCGTGCAATGGTTGTTTCCCAAGCTG
ATGAAATTCATTTGAAGCTTGTACAGCTGCATGGTAATAGTGATACGCCGCTATCTCCGCATCTGAACTATCCGAAGCGCGATATCTACGTCCCAACATA
GCGAACGCATCTTTTTCACCATTAGTTGCTGCGAAATGGATGAGC