Description :
From Genome Similarity Track
Location :
Scaffold_118:36971- 39220
Transcript NameFunction/comments
Hyaar_Emoy2810108Vtype proton ATPase subunit H putative
Hyaar_Emoy2810109hypothetical protein

Sequence
2249 bases(100 bases per row)
CGATACGAAAAAGAACTACGAACGGGAACACTAAACTGGGGGCTCCTGCACACAGACAAGTTTTGGAAGGATAACTTCATGACGTTTGAGAAGAAGGAAT
TTGAACTCATCCGGTAAGCGACAGGATCACGTGGAATGGTGTTTGGCTTTCGTTTTATTTCGGCTACTAACGCTGGATCCGACTGCAGGTTGTTGATCGA
CTTGCTGGAATCGGACAAGCCCAGGACCGTGGCTGTGGCCCTTTTCGATGTGGGCGAGTTTGTGCGCTTCTACCCGAATGGCAAACACATTGCCAAGCGA
CTTGGAGCGAAGAGGGTGGCAATGAAGCTTATGACGCACGAAAATGGCGAAGTGCAGAAACATGCCCTGCAGTGCATCTCGAAGATGATGGTCAACAAGT
GGGAGTTTGTCAAGTAAGCAGGCAGCAGATTAGCAGACTTGCTGCTTTGTTACCCGGTTTTATTTTTACGAGTGGAGCGCCGCAACGTGTGTTGAGGACG
GCTGAGTGCAGTCAAGGATTCAGCAAAAGCCCACGTAGGTATGCAATCAATACTTGTCTAACTGCTTCAATGACATGCAAGGTTCAGCAGTATCGTCCAT
TGTCGTGTATTGACACTATTAGCAGTTCTACCAATGAGGCATTTGACACCATCTTCAATGAATGCACTTGCTGCTGTGGCCAAGTACAGACAAACCACAG
CAGGTCTGTCGTGGCTCCTCAACGAGTAGTGACTTGGTCGTTGCTCGTGTCGTCTTCACACTACATTATTCAGCTTTTGTCCACGCGCGCCAGAGACCGA
TGGCAGCTTCCGCCGCGCATAGGAAACTCACCAGGCGGTCTGAAGCAAATGTAAAAATACAGTTAGTTTATGCACACGTGCCTGCTGTCAAGTATCTATT
AATAGCAGTACATTTGCGCACATACCTGAGAGAATTTTTTTCTCAAAAGACCACTGAATGCACGGCCCAACATACAAAAGGTTGCGCAGTTGCACATAAT
TTAGTTCGCGACACCTGCAGTCGCAGCAGTTACCGTTGACCTAAAATTAAGCGACTGGAAACAATATAAATAGAGCCACAGTCCGAAACATACCGATCTC
GGATACACGAGAGGAGCGTTGAGCGCTACAAAGCATCAAAGAGAGAGAGAGAGATAAATATAGAAAAATCAATCACATTTTGATTAGTAAAGAATAGATC
ACCACTACCTCAGTCACTAACAGCGATATTCATCACCTCATCATCCGTAAGATCTTTTCTGGCCCGGATCTGCTTTTTCTTTGCCTTCAGTGCTCGAATC
CTACCACAAAATGGTAACAATAATACACACCAACAGCCTCACTATGAATTATCCTGTCGAATTAAATCCTCACAACAAATATCCATTACTTGAACGTACC
GAAGTGCACTCGCATAAATATCCAAAAGAACGTAAACGCCCCACGCTCGACACGAGAGCCGAGAGAAATGCATCGCGTCGACTTTCAGCAGTTTAGGCGC
GCTACATTACACGCACCAAGTATCCGAGATAAAATCATGATAAACGATCAGTTTTTCCCGGATCCCGACCGTCCGACCAAATAGTATCCGACTTTTCCTT
TATCCAGGATTTAATTTTATCTATACAAAATACCCACACAAATCCCACATATGAAACGTGCTCGAGCGGGTGATAGACGACCATAGACAGCGCCTGCAGC
CGCACGAGGCGCTGCACGTGCTCGTCATCGTCTTTGCAGCTCCATGAACCCTTTTTCAACGCCGTATACGCCTCCAAGCCGCCAGTAAAGCGCAGGACGT
AGCGCGCCATCGAGATATTCGAGGCCAGCGCGTGTATATTCTGAGCCGTCTCCTGCTGCGCTGTGGGCGCGAAGAAATACGCAGCGGCATCCAGTCCATA
CGCTAGTGTCTTGTACAGCTTATCAGCACCTATCGAGCTACTGCTGAAGCGCACGAGCTTGTCGACGTCGAGAAGTGCTGTCATGACTATTTCGGATGAA
ATTTGATCGTCTCGGCTTCTGTTTAACTGCTATCGTGTCTTTCCGACACGATAGCAGTTTTGACAGGGCCGGGAAACACAGCTTATGCGGTGTAGCGATA
TAGTCCCGGTACTGTTTTGACACACGTACGAATTATCTCGATATACCGAGACGTTGGATTAATAGAAAGATAAATAGACGAACACGGTGCACCACGCTAC
TGGCTTCCTGCCTCACGATAGCCGTTACAAACGGGACGGGCAAATCGCA