Description :
From Genome Similarity Track
Location :
Scaffold_60:369601- 371276
Transcript NameFunction/comments
Aphas_H257_14878folate/biopterin transporter

Sequence
1675 bases(100 bases per row)
AACGCTTATCGTACATCCATTCTAAGACGGCCAAAGACGTTGATGTTGATGTGTACACCGAAGCGAAATCTCCCAAGGACCTCGAAGATGGGGCGCTGGC
CGATGGTGGGGCGCTGGACTTGTGGTCCCGCGAAGCGTTTGCCCTGTATATCCAGTACGGTGCCATCGGAATCATGTACGGCATACTGCCGGCACTCAAC
TACCCCATCTTCAACATCTACCTCAACTTGGAGGGGTACCAAACGTCAGCGTACAGGGTTTTGACTGTGATCGGGTGGTCATTCAAGGTCTTCTATGGCT
TGTTGTCGGATTGCGTCCCCATCTATGGCTACCGTCGCAAGTCGTGGATCTTGATCGGGTGGACCATCACGATGATCTGTCTGAGTGTGATGGCGTTTTC
TCCGTTTGGCGAGCCATTTTGCAACCGCGAAAAGACCAAGTTTTGCCGTACGCCGTTGGAGAAGGTGCCCAAGTCCGAGCTGCAGTACTTTAACTTGTCC
GCCCCCGACAACGGCACGCTGTTCATCCTTCTGTCCATGTTTATCGCGATTGGATACGTTTCGTCTGCGTCTGCGTCGGACGCGATGGTGGTCGAGTACG
CCCAGCGAGAACACGTAGCCATCCGCGGCCGCATCCAGACCGCCATCTACACCGTGCGCGAGCTCACCGGTGTCTTCTCGTACTTGTTGTCTGGGTTCGG
ACTGAACGGCCCTAACTACGCCGGGTCATTTTCGTTTGCGTTGTCGCCGAATGCTCCGTATGGCATTGTCTTGGTGCCGTGTGTGCTGGTGGTACTCTCG
ACGGTATTCCTCCTCGTGGAGAAGAAGACTGAGCCCTCGTCCTTCCCCCAATGGTGCAGCAGGTTTTGGGAATGTCTCCAGAGTCGCGTGATGTGGCAAA
TCTGTTTGTTTCGATTCCTGAGCAACGTGTTCTACGGCGTCAGAACCACTGCGGGCTTGCCCATCGCGACGTACTGGGCGGGTGTCGAACCTCTCAATGA
TTCGCTCTCGAACGTAATTGGCAATGTTCTGTACGCTAGCATGTTGGTGATTGTGGCCAAGTGGGGGCTCAAGTGGAACTGGCGGTGGACCATCGCCGCC
GGCACCCTCGGGATGATCATCATCGATGGCTTTGTCGTGTACATGACCATCTGGGACGTTGTGCGCAACCAGTGGTTCTTCACGGGTGTGGCGTTGATCG
ATAACTTTCCAGACGGCCTCCGCTTCATCGTGTCCACGTTCTGCGCTGTGGAAATAGCCGACAAGGGCAACGAAGGCGCCACGTACGGCCTCGTGACCAC
TGTGGGCAATCTCACGGGGCCGTTTGCCAGCATCTTTTACAAGTACATAAACTCGTTCTTCAAAGTAAGTCAGAACGACGTCAAGTCCGATACGCTCGAG
GTGCGGTGGGACGTCGCGTACGTGTTCATGATTTCGTACGGGTTCAAAGTGGCGTCGTTGTTTTGGTTGTTTTTACTGCCTCCCCAAAAGGCGGAAATTC
AGGAGTTGAAGGCGCGTGGTGGCAAGAGCAAAGTGGCGGGGGTGCTCCTCATTGTCGTTTTTGTCTTCTGCGTGTCGTTCGCCGTGTCTAGCAACATCAT
GACCATCTTCCCGTCCACCAAGTGCTACCGCATCGCAGGGGGCAACGGAGTGTTGGACCCGAAGACGGGCAAGTG