Description :
From Genome Similarity Track
Location :
Scaffold_269:3696- 6292
Transcript NameFunction/comments
Phyke_g8874hypothetical protein PHYSODRAFT_532657

Sequence
2596 bases(100 bases per row)
GGCGCAGCGCGCGCTGGTGACGGGCggcttccttctcttctcgtcgtccgTGGCGCTACTGTGCTTACAGCGCAAACGCGACCGCCAGCGTGTGTGGCGC
CAGCGTCTCACCTACAAGAAGCTCTCGAAATCGTACGATATTTGTCGATTTTTGACACTGTATTAGACGTCTTCCGCCTTCTTATTCTCTGTATGTGATA
ATATCATAATATGACTAGGTCGGATCTGGGCACGTGCTTTGGATTGGATATTGGTATGGAATCTAAAAGAAATAGCTGCGCTTAAAAATCTGTCCTAGCA
TTATTTGTTTTACTGAAACCTGGTGATACAGGCGGCACGCTGGCCAAGATCGTATACTTTGAGCGGCATGAAAATGCCAATGACAACCGCAAAAGACCTC
GCTCGGCCTCACACGACGTGGCAGCTGGGGAAATGAACAAGTTCCTGCGTGAAAATCATTCGTTTGGAAGTACTGGCGTCCAGGATGTTCGTCTGCGGAT
CCATTCCAAGACGCTCAATGGGGTGCGTGGCTGCTGAGGATGAAAATATTATACGATGAAATTGCTGCAATGAAGGACTGACAAGTGGGtgagttgctgc
aggtttTCCACTTTGTGCGCTtcgagagcagcaagacgCGAGATGCGATCGAGTTCATTGCCAACAACGGAATTAACCAGTCCCTTCGCATCTTGCCATG
CACAGGTGGCGGTGCTCACAAGGTCGGTGAAAAATCCACTTTATGCTACGTTTGATGTGTATTAAAACGGACCCTTGGTGTGTGTGCTGTTAACAGTATG
GGCCTGCTTTTAATGAGATGGCTGCGATCGAGCTAGAGAAATACGATGAGATCGAGTGTACTATTGCTGGACTTCATCTGTTGCTCACTACGTTATCTGA
CGAAGTGTACACCTTTGAGGTATGCATTTTCGTACGCTGTCTAGGAAGCGGTGAACGTTGATGTGCTGAATTTTTGGATTTGTTGCAGGACGTGGATTTT
AGCTCACTTGCAGCTTCGCGCGTGAAAACTATCCAGTACGATGTCGATGAGGACATTTACCCATACTTGGTGCGTCTACAGTATCTTCATCTGCCTCGCG
TTGAAATATGTACATTATAACCTATATGCAATGCTGGTCCAGCtcgtcagcatcggctcgGGTGTAAGCGTGCTTTATGTGAAAGGTCCCGGGGATTATG
AGCGTGTTAGCGGCAGTAGTATCGGCGGAGGCACTTATTGGGGACTTTGTCGGCTCCTGACTCACTGCGAGTCATACGATGAAGCCTTGGACTTGTGTGT
TCATGGCTCCAATCACTCGGTGGATATGAGTGTGGGAGATATCTATGGTGGGGCATACGACAAGTTCAAACTACCAGCTAGCACTGTTGCAAGCAGTTTT
GGGAAGATGATCTCGACTTCTCGCGAAAGTGTAAGCGATGCCGATCTGGCCCGCTCGCTACTGGTTATGATCACACAGAATATTGGTCAAGTTGCCTTCC
TGAACTCCTGCTTGTACAAGACTAAACacatcttcttcgttggCAACTTTCTTCGGCACAACAAGATCTCATCGCGTACGCTGGCGTATGCGATCAATTT
TTGGTCAAATGGAACGATGGAGGCCCGATTTTGCAAACACGAAGGTTATCTTGGAGCTTTGGGCGCATTCTTACGCCATGCTGAGGTTACCAATGCCCAT
GGTGAAGAGTTTGTGTCAGCTACGCGCGGTCATAAGCGTTACTCCATTTAGTTCATAAGCGCTACTCAATTTAGTTTATCGAGTAATAAATCGACCTCAA
CTGCTTAAATCACCGGTAGGATTTGCCGCTTCTATGATTGACACTACCGTCTTCCATCAAAAGTGCTCCTTAGCGTGTTCACATGACAGTAACGAAGCAC
TCATCGGCAAGGTGGTCATCGATTGTGGGCCATCCGTCGGTCGATTGCGCGATTCGCCGTTTGCACGTCACGCTTAACGCATAGATATGCCACAGCGGTC
CCCAAGCACCCATGATGCAAGCTTTCAGCTGGAAGTGTACTTCCAACACGACAGCGAGCTGTACGTGAATGTGTCTTTCATTCTGGAAATTCTTATCGAG
CAACCAAGTACAAGCATCCCAACGCATTTGCCATGCCAGTCAGTGTCTTTGGTTTCCACACGAACACCTCGCTGGACCCGACGTTCGATAAGGATATCCG
CGACCTGCACTTGATCAACGACTACGATGCTGGGTCTCCAGAAGGCAAGTCAGAGAAGTGGTGCTACGAGCTTTGGTTCTTCTCACACGACCGCGTGGTG
TATGCGATCCACGGTGGCCCCATGGCGGTTCGCATGAACTACCAGACATGCGCTTACCAGTGCATCCGCCCGGGCGAGCTGTGGCAGTGCAACTGGCTAG
AAGAAATCGGTACGATTGTAAGTCTGGTGTTCGacatcaagcagcagaaattgaCGGCAATGATCGGGTTCTCGAAGGGTCATTGGGAACACCCGATGGA
GGCGTACGGTGACAAGCGCAACGCCGAGGATTTTACCCGCTGACGCAAGCTGGCTGACTGTTGCAACCAGAAAgaccagctgctgctgtgcgaGTA