Description :
From Genome Similarity Track
Location :
Scaffold_1103:3696- 5365
Sequence
1669 bases(100 bases per row)
AGTGGACGCGTCCCCGTTGACTCTGCCGCCGTTCGGATCATACAACGCAGCTCGTCATACCTCGCACACATTCCATGCAAAGCGCGATAGCTAATCATNA
GCTAATCATCTCGACGAGGCCTTGGTCGGCACCTTCCGTGATGTAACCCAGCTGAGGCCCAGAgcgagcgtcgagcggcACAAGCCCCAGTACACGTTGT
CAAAGCGGCCCACGTGAGACCCCATATGCCTTGGCAGTTTTACTCTCGCTCATGCCGCACGCAACGGCGGTGACAGCAGCCCCCCATGTCTCCACTGGGA
CCTTCGACATTGGCCGTCTTCTGTGGCTTGTCGTATTGTTCGGGGGTGGGCGATCGACGGCTTATTCGAAAGCTGGATCCTTCCCCATTCTTCTGGGTGT
CCTCAGACCGGCCCAGGACTTTCATTTGCGATGATATCTGCCGACTAAAACATGACCAGTTTTCTCTTAttgacttgaatttgtataCCGAGCAAGTGGT
CCGAAATATGTCCGGCACGGATACCTGATGGTGCCGATGCATCCGTTCCTCATCTATCGGTGGAAATGTGCTTTCTCGATGGCCCTGTAGGTACGGGAAA
GTCGTTCATCCTTAAAGCGATTCTGGCAAGTGTCCAACGCACTGAGCGAACTGCCCTCGCAGTCGCGAGAAGCAGGATTTCTGCCGGCTTCATTTTGGTG
GACTACGGCGCACTCCGCATTTCGGCTCCCATTAGACCCTGACGAGACGTCCACTTGAAATCTTGGTTGGTGCTATCAGGTGATTTCAGACAGACGCTTC
CGGTAATTCCGAGGGCTGGACCGGCTGAGGTGATTTCTGCTTCTCTGAAACGCTCCGAACTGTGGAGAAGCTTTCAGTGTCTGCGCACGTCTATCAACAT
GCATGTGCGGACTGCTGTCAACCTAGACACACCATAAGATGTGCAAGCATCTGCAGATTACCTCCTTCGACTTGATGACGGATACCATGAAGTTTCCGCG
GGCTTGGATAGAAATTCGTGAAAATACCGAACGACATGCTTTTAGAAGTATCCAGTGTTGTGTCGGCTACGGTTTCGGAAAGTCCTACCCGAGACACAGC
GTCCAGTAAACTTCCACTGTCAATTGACAGCGTGTACGCAGATTTCAATGGAGGTAACCAACCAAACTGCTATTTCTCCGACATAATTATTTTGACACCG
CAGATCTCAAACGTTCTAGCGGTAAATGATATGATCCTGGAGAAATTACCTGGGGTTGCCAAAGAGTATCGCTCGGTGGGTAGTCTCGATGGAGATGATG
AATTGGAGCGCCAACAACATCGTGATATTTACCCCCCGGAGTTCTTGACACAATATCACTGAGTGGAATGCCTCCCCACAATCTGAAATTCAAAATCGGG
ACTCCCGTGGTGTTGATCCGGAATCTCAATAGGAAGGAAGGACATTGCAACGGAACTTTACTGAGGGTTGCGTCTTTACGTCGGAACTGCATGGTGGTTG
TGATTATGGGCGGATCATTTGTCGGCAAACGCGTCAACATTCCCCGGGTAGCGCTGATTAGCAAAACTGAGGATTCCCATTTGAGTTGCGAGAAAGCAAT
TTCCTGTGCAAGTGACGTTTGCGCTGACGATCAACAAGTCTCAAGGCAGTCAATTCAAAAGCTTGGATT