Description :
From Genome Similarity Track
Location :
Scaffold_261:36952- 38355
Sequence
1403 bases(100 bases per row)
CGCCATGAAGGGAATTTGGATGGGTTCCTCTTCAGGCCTCCGCAAAAACCACCACCACCAGAACCTGCTTCCAGCCAACTATCAAAACTACCCGCCCATA
GCCAACAACAACATCCTGTACAATTTGAGTCGCTGCAATCCCATCGCAGGCAGGCGGAAGAGTTCGACGTGAAACCAATTCACGGTCATGCCAAGTGGGT
AGGCTGCAAGTCAATCGTAGGCCGGTAGATGTCGCCGGCATGAAGCCAATTCACGATCGAGAGGAAGATGTGCCCCTGCTAGCCATTCGCGAGTGGGTGA
GAGACCCCGACAAGGAGTTAGCCTATGCTCAGGGTGAAGTCGCACCGTGTCAAAGGCGGAGAGGTTGTAAATGGCCAATTCCATCGCCGACGCTAGATAC
CAACGAAGATCAATGCTTCAAGTTGGCGCAGACAAAATTTTGCAGAAGCACGGTCAGCAAGACTGAACGATCTCGACATCTGCACGTTTTTCTACAGGGT
CAGCAGTGCCGATACACATTAACGGTGCGAATAAGGGAAAAGCTGCTGACACTAAATCAACGTACAGCTCAAGCTGGGCTCCATGCGGTACTGGCCCAAC
ATGGGATATGTCCACCAAAACCAAGCCCGTCATTTTCAGTCGTGAATGGAAAACAGCGTTTCCAGATTGATCGCGCGAAGCAGTTCGCGTACAGCGAGCT
AATTCGAAGGTCAAAAACGAGTCTTTCCGAGTTTATTCGCCTTGTTCGAGGCGAATCGAGACAGGATCCTCGTCCAAACAAGGCGCTCAGTGTGCCTGAT
CACCTTCCTAGCTGGCAATCATATCGTTACAAGAATGAGTGGCGCGACATTGTGACCAACGGGGTCAATCCGACATGGGCGTCACCGTTTCCTTTCCAGG
AGAAGCCCCCGCCAAATCACAGGTCCGCTGCACGAGCTTTCAATGCAGTGATAAAAAGCCTTCGAAGAGGCCAAATGACGACCGCTACTTGATTCTGGAT
TTAAGTCTACTGGGCAAGTAGGAGAGTATAACGTGCAATCCTTTTGGAGCGGTTCCGAAGGGCAACGAAGACCTGACGATCGATGCCAGGGTGATACATA
ACCTATCATACCCAACCGGTGCCTCCGTGAATGATCAAACCCAGGTCAGTTGCGACATTGACGTAAAAGACGACGGGACCGCGGTGCTGCAAGTCGAAGA
GGTTAATCCAGGTACTGTTCAAATGGCTACAGGAGATGTTACGGGGGCGTTCTGGAACATCCCTCTTGCTGCGAGGTTGGCGGGTCGATTCGCAGGAGTA
ATTCGTGAGCTGAACATCCTGGTGATCAACTTGTGCTGCCCATTCGGCTGGACTGATTCCCCACGCCATTACCGGGCAGCAGGAGGCACAATTATACATC
TTC