Description :
From Genome Similarity Track
Location :
Scaffold_120:3695- 5029
Sequence
1334 bases(100 bases per row)
ATTCAAGTCATGAGCCCATCTCGCGACGATTCTGGCATCACGCATCTTCCCGAGATCTCTTGGGATGAGTTGCTGCGTGATCTGAAGAGAGGGGAGATTG
ATCAACTATGTCTAGTGGTCCAAGCTTCGGATCCCGATAACCACGAACGCCCTGCGATAATGGAATGGAAGCCGCTCGCGAAGAGCGCTTCGCGGCACAG
TCATGGGACAATCTTGCAGCGTCTCAGAGTCTGGCTCTTGAACTAGCACGCTAGTTTGCTGACGTCTTTCTGGAAAAGATCCTAGCCGTACTTCCGGCAG
ACCATGGCGTACGGCAAGTAAAAAAATCTCGTGTCTGGCCCGAAGTGTTGCGTTACTCGCCAGTGGCCGCTCCCACGTGATCAGGTTAAGTCATTGATGC
ATTCTTTGAGGGATGTCGGTTATCTGGCCACGTGTGCGAGAGCACGTTGCCTCATGTCAAGAAGGCGACTGGGGATGGCGTATCATCCACGCCTTCAACA
AGTTGAACGACGAATTGATTCCAGCGCAGACGCCCATCCCACCCAAGGACATGGTGCTAGAAACCGTGTCGGGCAGCACGATTTTGTCGTCATTGCATCT
GACGGATATATTTTATCAGATCCTCTTGCGCCCACAAGACGTTTCATTGACCTCCGTCAGAAAACCTAGCGGCATGCTCTGGTAGCGGTTTGTGATGCAG
CAGGGACTCAAGATCGCCCCTGCCACATTTTACCGCATGGTGTCTCACTTATTGCGTCTGTTTCGCGACTTTGCGCCAAGTTAATTCGACGATATTTTTG
GTGATAGTCGCGCCGCCAATGGCGCGACGGATCTTGATGTTCACCTCGGCCACCTCCGACATGTGTTTCAAGCTATGCGAAATAATAATTTGTACGCGAA
CCTGAAGAAATGTATCTTCTGCGCACCGGAGATCCCTGTGTTTGGTAGCTACGTCGGCGCGAAGGGTGTTCGCGCTGACCCCTGAGAAACTGCCGTCAAT
CTGCGCATGGCCAGTCCCACGTATCCAAAACAAATCCCGCAATCGTTCGGCCCCGCGAAATACCTGCATCATTATGCGAAATATTTTGTAACGGTCATTC
ACCCGGTGTCTCAATTTTTAAAGAAAGACACCACATAGTCATGGCGTCTGGAGCACCAGCAGACGTTTGACTAGGTGAAAAAAGGCGCCTCTCGACACCA
CTGGTATTAGCCCTGCCGAACCACTACATGACAAATCATGCCGCATGAGACGAGAGTGACCTTGCGTTTAAATGCGCGCTCACGCAACATAACGACGCGG
GTTATGGACGCGTCGTGAGTTATCAATCTCGTCA