Description :
From Genome Similarity Track
Location :
Scaffold_11:369426- 371407
Transcript NameFunction/comments
Physo_341465secreted RxLR effector peptide protein, putative
Physo_528980Avh164

Sequence
1981 bases(100 bases per row)
ACGGGTCGTCCACCGTGCGCTCGAAGCCTTGTCGCTTGAGAGAAAAAGCTGTTCTGTGTTGTTGCCCAAAGGGTTTATCTCTTCTATCTTGTCTTTCCTA
TAGTACAATACAAATACTAAGTCTAAACGTGTCCGTTTCGGATCTTCTAGCACCAACAGTCGCCGCCGAAGAGTCGCCGAATACTCTTAGGTACGCGAAC
ATAAGGAAGGTGCGTCTTAGGTGCGAAACTCCTGCGACTTGAGCCGTGGTGTGTACCACATCTTCAACTCGGGAGGTAGCCATCCGCGACGGGCTGCGAC
CTTCACTCACGGGCGCCAATCTCGAACTCCCGTCAAGATGGCGGGGCGTCACGGACCGCGCAGCCAATCATCGCCGATCCCGTTGGTACTTGGCTTTTGA
CGCAATTTGCTGCAAGCTGCTGCTCAGGCTGCGGCGAGATCTCGGGGGCAATTTCCAACACCATATGGATCTCCTAGACGACGAGGCTGGCAGGAAAACA
AGCAAACGAACAAGTCTACAAAATCCTTCGAGCGTCTTACGCCGACGACGAGCTGGCCGTGATCCTACTGGGAGCGAAGAAACACTTGATGGGCGATGTT
GCTCAGAGACTGGAGAAGGTGCAGCAGAAGGTTTGGACTGGTGAAAAGAAAACCGCGGAGGCAGTGTTCGCCTCGCTGAAGCTGGGGGGCTACCAGGGTG
ATGGTGTTTTTAAGAGCCCGGCGTTTAGCTACTGGGTCGACTATGTGACGAAGCTGAGTCCTGAGAAGGCGGACGAGTTAATGCTGTCGACTCCGAAGAC
GAGTTACAAGGACGATGTTCTGGCCAAAAAGGTTGTTACAGCGAAGGAGGGTTCCTCTACAAAGCCTATTGCTGGGCAGTTGGAGAATGCTCAGATGAAG
GACTGGCTGCGCAACAAACGGTCAGTGGATGATGTCTTTAAACTGTTAAGGCTGGACGACGAAGTTGATAACCTACTGCAGTCCCCACTGCTGAGCAACT
GGGTGATTTACTTGGGGAAGTTGGATGAAAACCCGTACACTATATTACTGGGGAAACTGAAGACTTTCAAGCTCACAGCCACTGACGATAAGCTCGTCGA
CATGCTCACGAAGGCAAATCAAGATGTCAGTACCAGTGTGCTTGCTGATAAGTTGGAGACGGCACAGCTCGACAATGGCTGAAGGAGGATAAAACCGCCC
ATTATGTTTACAAACTGTTACATGTACAACTGGATGACAGTCATGGCTTGCTTTTGGTGTATCCATCCGTAGAGGCTTCGGTGAAGTACGCGGCAAGGCT
GGATTCCCAGAAATCTGACGATATCATTTTATCGGTGCTAAAACTACACTACACCGACACCAAGATGGCTGAAATGGTAGTCACAAGAAGGAGCCGCAAC
AAAGTCATAGCAGCCAAATTCCAAGACATCTTGTTCAAACATTGGCTGACCGAGAAGAAGACCGCGGATGGTGCTTTCGAGTTCCTGCTAAAAAGCCATC
GCGCGCACATCTTTGAGATTTTTGACAACTTGGAGATTTGGGTCTCGTTCGTGACCAAACTGGATAAGGGAGACGACTACAAGACGATATTCTCGGTCCT
AAAGAAGCGCTTGGAAGGCCGAGAACTCGCTAACATAATTTATGACGCAGGAGAAGTTGGTCGTACTGCGCTACTTGCCAGGAAGCTAGAGCAAGAGCTT
TGGTTAAGCCAGGGGGAAAACGCGGAGGGTATTTTCAATCTTCTACATCTAAACGATGCAGAGACCGCGTTGTTTAAAAAACGAGACTTGGCGACGTGGG
TTTCATACGTAACCAAGCTAGATGCGAAGAACGCGGACGAAATAATCTTCTCGGTGCTGAATCCTCCCTACACCCAGAAAGACTTCGCGGCGATGCTCAC
GGCAGCCAAAAAGGTTGAAAAAACGGAGGATCTTGCTATCAAGCTGGAGAAGCTATTCGTTCAAAGTCTAGGAAAGTAAGC