Description :
From Genome Similarity Track
Location :
Scaffold_42:36935- 43907
Transcript NameFunction/comments
Phyag_g1048tRNA pseudouridine synthase
Phyag_g1049hypothetical protein PHYSODRAFT_320443
Phyag_g1050conserved hypothetical protein

Sequence
6972 bases(100 bases per row)
AAAAAAAACAGATTCCCACCCAGAGTTTAGCTCGCAGTAGATGCCGCCTCGGGCTTTGCTACTACTTCTGCGGCTGCCGCTCCCACTGTGTTGTTAGTTT
GGGCAGCTACTTCTGCACGCGCTGCCTTTGCCAACTCGCGTCTGCCAGCCCGGTCCgtacgagcagcttcttcttctttttcctTCTTCCACTCCAAATA
GGGCTTTGCAACGTAGTCGAATGGCAACACCTCCATCGTACGCAGCCACTTTGCGTACGTACGAGTACGTTCTTCGTGCTTCATAATATGGTCAAAGACA
AAGTCACGCTTAAATTGCTCCACcgcggcagcaacggcaggTTCCTTCAAATCGAGCGGTGGGTGCGATGTCTGAATAGACTCCGCCATCTTCATGTTGT
ACACCTCAAAGTGCGCTTGCGCCAGGTACAGTCCAACGCTAGGCGCCTTAGGCAAGTCCATCTTGGTCAGCTCAAAGGCGCGTTCAATCGTCGACTGGTC
CGTCACCCCTGAAACAATCTCCACAGCCGTGCCGATCATCTTACGAATATGATGCAACAAGAAACTCTGTCCCACCACACGCAGACGCACCCACTCCATA
TCATTCTGCACGAACGGTTGGTCAGCCTCAAAGGAGATAATAAACCGATTAGCCTGCGGGTTGGTAGGCTCCATCTTGGACGTAAAGTTGTGGAAGTTGT
GCGTGCCCACATACTGCTTCAACGTCTCGTTCAGCTGCGTCAGCGTCGCGTCACTCAGTCGAAAGGCCTTGTGAGCCTCGAGCGTCGTGCTGTCAATCAC
CACCTTGTCGTCAAAGCCTTCCTCCGAGTCTCTCAGATCCGACGGCCactctttctccttctcctcactCTTCTCTTCCGTTTCACACACCCGTTTACCA
AAGATAAACGTCGGCGCAAGGTACTCGTACGTGCGTTGGTCGCACGACATTTTGGCGTTGAAGTTCTTGGTGACGGTCACCATTTGGACGACGCGAATAT
CGTCCGGCAGAGCGACGTTCACCTTGGCTAAAAACTCTGGGATATCATCCCCAACATGAAGTTTAGCCGTCAGCAATTGGCCCGCAGCGTGGACGCCCTT
GTCCGTGCGGGCGGCGCGGCTCCAACCGATCTTCTGCAGGAATCCGTAGTTGCTCTCGGCGATGCCGCCGGCCTCAAACAGCgcgcgctccagctccgcc
tcgATGGTCTTCACGCCCTCGTTCATCTGCATGCCGCTGTAGTTCTTGCCGCAGAAGGCCACCCACAGGCCGTAACGGCGCTTGGtcggcagcgacgcag
ccTCCGTTGGGGAGCTTGAAGGCTGGCGCTGAGCGGCGTAGGAGCCCGGGTGGATGGCGTCCGAGCGGTCGGCGCGGTTGTCCGGCTTGTCCTGCTTCTG
TTGGTTGCCATCCTGCTGGCCGTCGCGACGCGCCTGCTTGTTCTTGCGGCGTACAGCCCAAtgcgtcttcttgcgcttgcctGCCATGATGCAACAATGG
CTGGAGACGACAATGTGTACGACCGTGCGTACAAACTACCATTTCGCATTTACGAGGTGCAGTCCATCAGATAGTCAAAACGATGGTATGATGTCGGACA
CGGTTGCGAGCCTCCATTTACCCTCCACATTTAGTCAGTCCTAGTGGAAGATGGTGTCGCTGCGCAGTCTCCAGACGCTGCGTCGTGCGGCGCAATTGGC
CGTAAAGTCGTCAGGCAACCAATCGGCGccgctgcaggcgctggcgcagacgcGCGCCTTCTCGCAGGCCCACACGCCCACGCAGAGCGTGGACCCGAAG
GACATTTTGCGGCCGGAAGTGGCCAAGGACGCCAAGCCGCAGCTctcgctggagcaggagcttccAGGCCTTCCCACACTGAAACCTGCTAGCCAACTGA
AGCCCCCGCAGACGGAGATCTCCGTTCTGCCCTCGGGTCTGCGTGTCATCTCGCAGGAGACGTACGGTCAGGCCGCCACTCTGGGCATCTTCATCGACGC
CGGCAGCCGcttcgaggacgacgagagcgtgGGCGTGAGTCATCTGTTGGAGCACTTGGGCTTCAAGAGCACCACGTCTCGCTCGCATGCTCAGCTGGTG
CACGAGATCGAGGACGTTGGAGCGCTCACGACGTCCTCCTGTGGCCGCGAGCAGATCATCTACACGATTGATCTACTGCGTGACAATGTGGAGAAAGGAC
TGGAGCTGCTAGCGGATGCTATCCTCAATGTGGACTTGGTGCCGGAAGAGATGGAGGGCATCAAGGCTATTATGCGCATCCAGACGGAGGACCTGATGGA
GAACCCGCCCGCGATGCTGCAAGAGTTCAtccatgctgcagcttatGGTGTTGATACGCCGTTGGGACGACCGCTGCAATGCCCATTGGACAAGATTGAC
GCTCTCacggtggagaaggtgaagaagttccGTGCCGAGCACTTTGTCGCTCAGAAGATGGTGCTTGCTGGCTCGGGTGTGGATCATGCGCGGCTGGTGA
AGTATGCGGAGAAGTTTTTTGCCAATGTACCTGTGGCTCCTGCTGGTACGCCGATGGCGACGCCCTCGAGTCCGGAGACGTTGGAGCCCGTGATCTACAC
GGGAGGACTGTGCCCGCTACCGAACCCGGATTCGGAGTTTTCGTACGCGGCGCTCGCGTTCCCCACGGGTGGCTGGCATGATGAAGACCTGGTGCCCATT
tgtgtgctgcacacgctgtTGGGCGGCGGTGACAGCTTCTCCGCTGGCGGTCCTGGCAAGGGCATGTACTCGCGGTTGTACACGAGCGTATTGAACCGCT
TCTACTGGGTCGAGTCGGCCTTCGCTTTCTCGTCCATCCACGCGGATGTTGGTCTCCTGGGCATCTATGGTGCTTGCATCCCGTCGCACACCAGCAACCT
CGTGGCGCTGTTGTGCAACCAGATGCTGAGTGTTGCCAACCGACCCGTCGATGCCATTGAGCTGGCGCGCGCCAAGAACCAGCTCAAGTCGTCTGTGCTC
ATGAACCTCGAGTCTCGCATGATCCTGTACGAAGATATCGGGCGCCAGTTGCTGACGTACGGCGAGCGTGAGACGCCCGAGTCTGTGTGTGCCAAGATCG
ACCAGGTTACGGCCGCAGACATCCAGCGAGTTGTGAAGGAGGCCATGCAGAACCCACCTAGCCTTGTGTACTCGGGAGACATCCCCCAATTCCCGCAGTA
CCAACAGGTCGTCGCCGGTATCAAGGAAGGACTGAGCGAGTAAGTGCATTCCTTTTTAGCTAGTCAGTCAGGTTGTGTCGCGAGGCCTCCTCCACCCACC
ATAACTCAGCGAGATCACTGTATAGCAGAAAGCACTCGCTGCATGGAAGAAAAAGCAATAGAAAAAGGGTAAACGATATGCATGCAGGTTGCTTTGCTTG
CTGTAAACTACTCATGGTTTAAATATCTAACGGCGTTTGAGTGCAGCTTCCTCGTGCAACAAGCGAAAGCCTCGAAGGTACTGCTGGCACTGCGCGGTGG
TGTCTGCCTCTAGGTCCAATGTACGGCAAGGGTTCACAAACACGAGCGAGAAACAGCGAGTGGGTGCATCAGGTCGCTGACGAGCAAAAGTCTCAGTCGT
AGCACCAGCCAACACCTCAACCAGGTCGCACGTGTCGACTTTGGAGTCAGCTTTAGGCTGCGTCAACGAGCCGGCGATGGCTGGCGAGCACCACGACAAC
CAGTGGCACTGAACATCCGCATACACAATGCGCTGATGAGGAGCGCCCCGCACCCCGAACTTGGTCACAACGATGCCGTTTtcaagctgcttcttgaact
GCACAAGGAATTCCTGGTCctttgcttgagctgcagcgcgtgcacgACTAGCGCTCTCCAATTCATTAACTGCTGCCTGAAGTCGATTCTTCTCAGCACG
TTCAGCCTCACaacgctgctcgagttcgcgAATCTGGAGCTGTAAGTCGTTTTGTGCGCCTTGCGCTTCGTTCTCTGCGTTTTGTCGGACAACCTCGAGT
TCAGCACCAAATTCGCCACGCATGTTACGCTCGCGGTTCTGCGCTTCTCGTAACTCATCGTGCAAGGAGGCCAGTAGCTGCTTGCTAGTAGTGTTCACTA
GCTCCAAAGCGTGAACTTGTTCCTGTAACTGTTGTAGCTGTTGTTCGTGGCACAACAATTCCGACAGCAACTCGTCTCGGTGCTGGTTCAAGTCTGTGCT
AGTGTCCTGCAGCCATGCTTGTAGTGTACgagttgttgctggacttgtgcCACCTTGAGGCAGCAATACTGGTGTATGCTGGATTGGTAAAGGAATTCCT
GTGGTAGGACGCTTTTCTTCTGCTagtggtgctgcttcagctgctgcagcaatacgCGCGTTGGCGGTCTCAAGTTTTGCTTGGAGATCCCGCAGCCTTT
GAGTCTTGGCTGCATGCGACGTCCGAAGCGCTGCCAGCACAACCTCGACTGCGCGATGTGCTCGCTGTGCGTCAACTAACCGATCGTGCAACTCGTCCAC
TTGCTTCTGTGTGTCTCGGTATTCctcttgaagctcttgccaCTGCAGTGCCAGCATCTCTTTCTCGTGTCGAAGATGATTTACTTGTTCCCGACTTTCC
TCAGCGGCCGCTGTCTGCTCAGCGAGCTGAGCCTGGAGATCTTTCAacgtctgctccagctcctcttggtgctgctgcaattgaaCTTGCTCACGCTTTA
CCGATTGCAATTCGGCTTGCGTGGTCGCGGACGTCCGCTTGTGTCTCAAAAGTAGCTTGTTGACTGCTACCATGTCATCGCGTTCTCGCTGCACTTTGCG
GGTCTCCTGCAGCAAGGTCTCAAGTTGACGCGCTGCCACTTCTTGCTCTTTTCTCAccgcttcatctcgttccTGCTGCGACGCGATCAATTGCTCTCTC
ACCGAGCGTAGCTGCTGGCTCACTTCAAGATACTCTGTCTTCAAGTTGCTCACCAATGCGTTCGAGCTTTCTGCATCTGAATCCGTATACTCAGGGAGCT
GGTGGCAGTCGCTTTTAATTTCAAAACTGCCTTGACTACAGCGCCGTGAGCCAGACTTCCCTGGCCCCATCGATAGACTGCTTCTGCGTCGAGTCTGCCG
GGGTGAAGCAATATTTCCTAGACTCTTTGATCGCTCCACAAGGCCTGAGACAGCCAGCCCTGAATTGATGTCGGCTAGCGTCAGAGTCAACGCTGGCTTC
GCGTCGCGCATCCTACGAGTGAACAAGACAAAACACCCACGAATCAGTACAATGATACCCTGgagttcgagcagaagaGAAGAATGCTCACATTTGAAGA
ACATCAGCGTACGCTACATTCGCGACGTCATTCCCATTTACCATGCGCACGCGCAGTGTGTCGACAATGATGCGAGAGTAGTCGCCTGCTGCACGGCAGC
GTGCATTGTAGTCCGCTGCAAGCCCCACTGGGCCAACATCCCGGACGACGCAAGCATAGCTTTCGGCAGGAACGACACTGAGCTTGTTGCTCTGTGACGC
AGGCTGGAATCCAAGACCGACAGGCTTGCTATCGTCGAAGAACACGCTGAACTCCTTCTCCCATCGACAAGGATCTTCACTTTGCTTGGCTCGAATAGTG
ACCGCCAAGAGGTCATTCCACGCTCGCTCTGCACGAGATCGTTGTCCTTGGTCCTCCTCCGAATCATGGTTGCTCGAAGGCAGAGCAGAACGCTCCTCAC
TCCACGGTGGGCTGCAGAATTTGAGCACCATATTAACTGCCTGCGGCCACGCCGTCACTGATGCTTCTGAAAATGGATTCTGGGCTAGCGAGCGGAGGAC
CCCGGTTTAGACAGCAAGCTCTCACATCCAACAATAGCGCCCAAGGCTGCGcatcaacgacaacaacacctTCCGGTTAGCGTACGGGGTTGTTATTAGC
TTTTGACAAAAAAAAGATCAGCGTCCACTGCTCGCCTTCCATTGTATCTTGCTTCAGTTCTCCTGCTTCactcgcagcttcttgcctaAAATTCCACAGC
ATCTATGGCTGTGGAGAACACCCAGGCACGCGGCACGTTGCTTTTGCTGAGCACGAAGGCGCGTGCGCTCGCACAATCGCCGCCCAGAGTTTACACGCGC
CGCACCTGTTGGCATCGTGCGTGGCTTTGCCCTCCATGCTCTTGCGGTGAGCTGTCACTTTCTCCACAAACGCGCGCGAAGATACACAGAGCGGGTTGTG
GCACCCGATGGGGCTACAGCTCGCCATGTGCTGCAGTCCACGAAGTATCGACTGCATCTGCGCAGCTCCAGGAGTCGTCGCTGCCTTGGCAGGAGGAGGT
CGTTTCTTGGCATCCGAGACTTCCCCTACTGACGTCGGACTCGGCGGCTCGCGACGTAAACGCTTGGCTGACGGCGGAATGGGCAGTTGGCATCTGagag
acgccgctgctgttgctgttaATTCTGGGGACGACGAGGCGGCGATAGACGACGCAGGAGCCGGCAAGAACGACACGAGCGGCGTCGCAAAAGCCACGCG
AGGCGGCGTCCGCAAAGACTGCGACTGTGACGCGACAGACTCGCCGCTGTGACTGCGCTTCCTGGAGATGGAGAGTCCATTGGAGACGATCTGCGAGCGC
GAGATGGAGTAGGACGGAGGCGGACGCGAGAAGGACGGTAAGTGGGGGGCGGACACGGAGCCAACGGCGTCTCGATCAGTCCCGCCGTTCGTTGGGCAGC
TCTGCAATAggaaggagaccaagaatGGGTTAATTTCTTCTGATACTGCAACATAGCTCTAAATTAGAGAAAAGAACGCACCATTTCAGCTCCATCGGcc
acgaggagaagatgcgCCAGCTTATCGACGCGGACGGATCACACACGTCGAGACACGGAGAGAAAAAAATGAACTggacgagggcgaggacgaggagaag
acagCGGCGAGAAGACGTCAAGTGCCGCGCTGCGTGTCTGAGAATGGACCTTCATTCAACTGGGGCTAGGGC