Description :
From Genome Similarity Track
Location :
Scaffold_51:36934- 39196
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_51-fgenesh-gene-0.8CREG
Pytve_DAOMBR484maker-pve_contig_51-fgenesh-gene-0.22Phosphatidylserine synthase

Sequence
2262 bases(100 bases per row)
CCACGCGCGTCAGCTCGTGCACGCTAACACGTGGGGCACGATGGCCACCACGTCGCTCCAGTTCGACGGCATCGCCTACGGCAACATCGTCTCGTACAGC
GGTGCGTTGCGTCTCTAATGCTCGTGTCGCTGGTCTATGACGAACTTCTCTCCTGACTTGACCGACCGCTATGATGTGTGCAGACGGCATCGGCAAGGAC
AACGCCGGCTCGACCGGCGAGCTCTTCTTCTACCTCACGCCCTTGGACTTCACCGGTATGCACACTCGACATCGTCGATCATTGTTGACTTATTCAGGGT
GGCTGACTGCAGTCTGGATGATCTGTAGCGGCGGACCTGGCCAAGCACCCGAACGCGACGCTGTCGATCTCGCTGGCGCAGGAGGGCGAGCACGCGTGCA
AGCTGGACACGGAGGACCCGACGTGCTGGCGCATCACGCTGCTGGGCAGCGTCGCGCCGGTGGCGGCGGACCGCAAGGCGCACGCCGAGGAGGCCATCTT
CTCGCGCCACCCGGAGATGCGCTACTGGCCCAAGGACCACCTCTTCGCGCCGTACGTCATGGAACTGCACCACATCGTGCTGCTCGACTTCTACGGCGGC
GCCAAGCACGTGCCCATCGACCAGTACTACGCCATCAAGCTATGAGCCTGGCCGGTGTGTGGGGTATCGTACCCTCGCCTCCACTGCATGTGTGCATCTC
GTTATCAATGCACATTGGCGTTCTCTAACTTCTCCCTACTACTTGCACTTCCTTTCGTCGGCTGCATTGTGCGTCCTCCGTTGTCTTGCAAGCCTCGTGG
TAGACATCTACTCTCTCTAACAGTTCATCACGACGCTAATACGCCCACTGGGTCGTGAGCAGCAGCAGCGGCGAGAACGAGACCCAGAAGAGCACGTCCA
GCGCGCTCCAGCCCGTGACACGCTCTCCACGCGGCGTGCGTCCGCGAGCCTTCTGCGACGAGAAGAAGAGCACGACCCAGAGCGAGAAGAGCGCCGCGAA
GCCAACAATGGCAGCCAGCACGATGGGCGGCGGCGACGCCGGGAACAGCACGCCGTTGCCCGAGAACTTGAGCCACACGAGCACCTCGAAGACGGCGATC
GAGAGCATCATCCACGAGTTCTGGCCGAGACGCCAGCTCTCCGGGTTGGACAGGAACTCGTAGTACTCGGCGGCGGCCGGGATGCCGTTCAGGAAGAGCA
GCGTGAGGCGGTACGAATTGAACTTGCTCTCCTTGGGGATGGAGAGCGCCACGAGCATGAAGAAGGCGTTGAGCTCCGTCACGAGGCAGATGATGATCGC
GAAGAGCACCTGCGCGAACCGCGAGAAGCTCGAGAACACCTCCCAGTGGTACTGCGACCAGCTGATGGGGGTGAGCTGTCGCAGCGCGAAGCGCACGTAC
CCGACCTTCTCGCCCTTCTTGCCCGACCAGTCGTACTCCTTCGTCTGGCACAGGTACAGCGTCACGCGGCCAAGCAGCATGCCCAGGATGTTGGCGCCGA
GAAGGTCCATGAGCAGCGAGTCCCACCTGCAGACACACAGACAGAGTAATAAATCAGGATCCATTGTCCACATCAATCCACACACAATGATGACGATGAC
TGCACGCACCAGCACTCCTGGAAATCCGGGATGATGAACTGCAGCGCGAGCTCGAGGCACTCGAAGGCGACCGAGAGCACCCAGCAGACGCGCCAGTCGC
GGAACATACACATCTTCCCCCACCACCCGGCCACGTGCGCTAGGAACCAAATGCTCGACACGCCGCGGTACAGCGACTTGGCGTTGATCTCGCACTCGAG
CCCGCCCGAGTGGGTCTGCCTGGACATGTCCCCGACCTCGGGGAACAGCACCTGGAGCGCAGAGACGGCGCCTTCGCGGTTCTGCACCGACAGCGCGGCC
AGCAGCAGCAGGTACACGACCGAGCAGCCGTGCACGATGCGCCAGAGGCCTGGGTGGGGACGCACCATGAGGCCGTCGCGCGTCTGCAGGAAGCAGTAGA
CCAGGAAGATGAGCACGCCCGCGCTCAGCCCCGTGCGGATCCGCTCGTTGGCGTCCTAAACATGCAGTAAATGGAGATCATAAGCCCATAAATCAGGTCA
TCGGTGTCAATTGTCCACCACACTTCACCTGTGCGTCATGCGTGAATGAGTAGTACGAGAACGCGGCCACCACGAGCGCCAGCACGGCGATCTGCCGCGG
CTGCTCTCGGAACAGCAGGTGCTCCTCGACGGCCGAGCCGCGGGCCGCACGGAACGTGTTGT