Description :
From Genome Similarity Track
Location :
Scaffold_222:36924- 40098
Sequence
3174 bases(100 bases per row)
ATTTGTAAATAGAGATGGTTAAAAAGAAGGTAAAATATAAAGCGTTAACAGAATATGTAATACATTGAAAAAATTCTACGTGTACTCTTCTATTCATGTC
TACTTTGTGGACTGACCTTTCTATGAACGTACGCGTAAGTGAAGTAATCAATGCAACTACTTACACTGCTGTCAGTGAAGTAGCTTTAAAAGTCTGTTCG
CTCAAATGTAACCCATCGGTACCAGCGCTTAATACAAAAAGAGTAGATACAGCCGAACGTACTAATGTTTAGATACTTAATGATGTAACTTCAGGTAAAT
TTTACAACAGCCAAACATATTTGCGCCTTGCACAATAATCCAAGTCCAATTATATTCAAATTCAGGTTAGTGTAAAAAAATTCCAGTACAAATGTCTCTC
CTTGCTCTCAATTAGGTTTCTAGGTCTGTATTTCCCAGGAGCAAAAGAGACGTCTCACATATTACATTCTTCCATCGTCTATTATTTAAGCTTTCAGTTT
TTCTTGTCTTCTATTTTGTAAGTCAATAGCCTGGTTTTCTAATATCCGACGATATCTCAACGAGAAGACTGCGAGGTTACCCGAGTTCGTACGGCGACCA
TTCGCCGGACATTTTGAGAAAAGGTACCTATCTTCCGACTAAATCTACTTCGTTTCGGAAAAGTGAATGCGTCTCATATTTGTACAAATCACCTTTCAGC
TCAATGGTCCTGCCTCTCTTTCGAATATTGTATACTGTATGATAATGTGTAGGGCTTCAACCTGGACATGGTTTTGTTGAGTCGACCCGGTGATTTACCG
GACTGGTCCGGTGAACTGGTCGGCGGTAGACCCGGACCACGATCGATGTATATATTTTAATTTATTACTGCCACGACCACCAGCAAAAAATGCGAATGCT
TCTTTTATTTCTGGTAAGATTCATAAACCTTTGTCCTATTTCCAGCATAGCCTACAGCTTGGAAGAGGCATAACTGGGGATGTCTCGATAATATCGGTTT
AAAAGTCTACACAAAAAATTTGCCTTCCGAAGAACTCTAGAGAAGCTGACATATAAATTTATAGCTTGGCGATGCGATCATAACCTGCTACATACATCGA
CTCTACCGATGGTGTCAGTCAGTAAATTGAGTGTGCTGCTGCCACTAGTGGCTTTAAAAAGATAAATGGGGTATGGACGTAATTTTAATACTGAAAGAAA
AAAGAAAAAATGTTTACCAAGTCTCAAGGCTCGTGGCCGATCAGCAATTTCCGGAGCCATGTGTGAGGCGCAGCGATCAGGGCCAGGCATTTGGTGACCA
AGCATCAGATACATGAAGGCAACAATAACAGGGCTCAATGTGTGCATTTTATTCATCGGGAAATCTGAAGGTGGTACATTGGTTTGGTCCAAGAATTATA
ATTTTTATTCATTAATATTGTGTCATCATACAGAGACTTCAATTAGACAGGCATACATTAGTATTGGTGCAAATCAAAATATAATTATCGAGCTTTAATT
GCTCTACCAGATTGCAGGATATAGAAAACGACACAAGACTTTCAAGCTTTGCAATACAGCAACTTATTCATTGTTGACGTCGGCAGATAACATCAGACAA
GATGTTCTATAAATCTAAAACAAGGGTACATAAATTCTCTAATATTTTAGCCAAACACATTGGATTAGGTTGTATCTGTTATATGTAATCACTGATAATG
TTTTTGATATCCTGACTCAAAGTGAATATCACTTTTGATTTCTGTAATTCTACCGATCATGGTTTGATAATGGGGGGATGACAGTTCATTGAATTAGTGA
AGACTGGAAGCTATGGAATCTTGCTATTCCTGCGATGGATATTGATGAAGACCACAATGGAAAGAATCTTGAGTATCATTTCTTAATAGATTTTAGAGCA
GCTCAATATTGTTGACAATCTCCTTTGAGTTATAGGCGACAATGCCTCAAACAAAAACGGCACTAATTGCAATGTTTTTGGAGAACCGGTACCTGTTTTC
GGAATTTTTGATAAAGGACATCGAGTTTGGTTGTATGGTACATGTGATTAATCTGGTAGCCAATGTTGGTTTCAAGATATCGGTGCTCATGATAAATGGA
TGATATAAAATATTGAATCAAATAGCAATCCATGTTTGTAGATGCGCTACTGTCGGAAGAAGAGACTCTCGTGTCACCTGATATTTAGTCTCAGGGGTTT
CGCAACGCCTTCCATTGTGAGAATCACTGCACGGTGGTTATATCAGAAGCGGAAACTTCTTAAGGTTCAGGGGTTGCATGGCGCAAGGGTCGCATAAAGG
ATAGGTAAGATTATGGACAAGAGAGGTAAAGCCTAACATGCACAATATACTCACTTCTACGTTTGCCACCTACTGTCCAAGCAGCTTAAGCGCCACGTGC
ATATTTAACAGCTACTTCTGGATCGAGGTACAGAAACCGAAAAAGGTAAAATATTTTTACTTCTTCATCCGCTTATGTGTAATTTATCGCAACTAATTTC
TTAACTTGATTCAAATTTTAGGTACAATAGCACATAGAACTCCTGACTTCACATAACATATTGTCGGCTCACCTCAAAGAATTTAAAATTGTAAGTGCTC
GCGGACTTTGTTGCAGCAGATACTGGATCCAAGAAGTTGGTGTAAGATGTGGCAGCGAGTTGGGAATCTCATGCACTTCGCTAATTAATTGCAAGTATAT
ATAGACAGCATAGTCTAGCCTCAAAAATATGCGCTTCAAGAATGTATCTGGGCCCTGCACAAGAATTCATAAAGCTGCTTGAACGATTAGAAGAGGTGTT
ACAAGATATTAATAGGTAAACATATCATTGTAATACGTTTTGTGTTTATTAGATGATGCGTCAGGCTATAGTGCTTTTATCATCTTCAAAGTATCCATCT
AGAATGGCAGCTGTACCAGTATTTTCCGTGCTCTTAAAATCATTAATGAGGCTCTGCGTTCATATGATGGTACATTTTTGGATAACTAATCCGAGCAATG
TAATGAAATTACGAGTGTAAAATGAGAAAGCTTATGTGTAATATGTAAACAAGCGTGCAACCGCATTGGTATTCGAATATAGATTATGTTTTAAAGATTT
GAACGCGAATACTTGGACGATAAGTGATCATTTCGCAGAAATCTCATCTGTACAATGCATATGAGACACGCGGC