Description :
From Genome Similarity Track
Location :
Scaffold_32:369235- 370492
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13364vacuolar protein sorting-associated protein

Sequence
1257 bases(100 bases per row)
ACCAAGACCCTGCTTTCCCTGGTAGTTCAAGCTCTTCGTCTCGCTCACTTCAAGTACGGTTCATGCGAGTGACATCCTCGACGTCCAAGACTGGCGGGGA
CTCGGACAAGGATGCAGTGGAGATTCGAGAGTACAATTTGGATGAAATGGCGACGCACAAGCGCATTCAGCTGCATCGCTCCCTGCCGTCTGAATTATTC
CTGAAGCCGGAGCAAAAGGGATACCTGCTGAAGAAAGACAGCATGCTCAAGTGGAACCGGAAGTACTTCCGGTTGTACGAGCACATGTTGTACTATTTCG
CCAACGAAACGGACCAGGAGCTCCTCGGAGTTGTCGATCTACGCACAGGTTCCGACGTGCCGGGTGTTGGTGGAGTCGCGATTTTTGAGAAGGCTGCAGA
AGCTCCATCAAAGAGCGGGTTTATTTCTTTGAATGGGCTGGTTTCTTCGATCTCGGGCAGTCTCTTCGGTGGCGGTTCGAGACAGAAAAACGGAGGTGAC
GATGACGATGATGACGATGGAGACGACAGGTCGAGAGAGCTTGTACGACTTGCAGTTTCGTTAACCACGTCCAGTGTGTTGTGTGAAGAGTCTGAGAAGT
TCGTGAACGCACATATTGAAAGTGGGACGTTTGCAAAGAGCGGCGTTACGCGGAAGGGCTTTTACGTGAATGGACAAGATCTAGTCGACTTCTTGGTGAC
AGAAATGAGTACACAGACGAAGGCGCAGGCGTTCACGACAGCGCAGGAGATGATGGAACTTGGTGTACTAAAGCCAATTCAGATATCGTCCGACGTGGGT
GCTCACAAACAAGCGCCGTTGAGAAGTTTCCAGTGCTCAAAAATCGTGTGGTACAGTGTTGACTCGATCAATCTAGCAGAGGACTCTGACTTGGACTCCG
AAGACAGTTCCAGCATAACCACACCGCGAGATAGCGATCTATCTGCCAGCAAGCCTGGTGCAATGCCACCCGTCATTGGGTCGAACCAATTCTCGATCAT
TACGCCGACGAAATGCTACGATTTGAAGGCCAAGAACCCGAAGATTGCTAAAATTTGGGTGAGACGACTACGGCTGGCTACACAAGGCGGCCAGGCTGGC
GATATCGAGGATATGCCAGAGGAGACACCGATGGCAGGAGCCCCCAAGACGGCACGCTCGCAGAGAGACCTTATTCCACAGGTTCAAAATGCGAAGACTT
ATGTTCATGTTCGCATCCGTGCAGATGGACCGACTAAGGTGTTGGAGCTGTTTGAAG